Observation international

Soortgroepen => Vogels => Topic gestart door: Gert Veurink op januari 16, 2010, 19:35:25 pm

Titel: rietgans, again...
Bericht door: Gert Veurink op januari 16, 2010, 19:35:25 pm
ik zag deze net staan, wat denken er van?
 
http://waarneming.nl/waarneming/view/46042415 (http://waarneming.nl/waarneming/view/46042415)
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 16, 2010, 19:39:00 pm
Oogt vrij fors, stevige snavel. Zou graag vergelijking zien erlangs.
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 16, 2010, 20:54:49 pm
ik zag deze net staan, wat denken er van?
 
http://waarneming.nl/waarneming/view/46042415 (http://waarneming.nl/waarneming/view/46042415)

Ehhhh.... niks eigenlijk, ik wacht dat artikel van Lützen af........... 8)
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 16, 2010, 20:55:01 pm
ik zag deze net staan, wat denken er van?
 
http://waarneming.nl/waarneming/view/46042415 (http://waarneming.nl/waarneming/view/46042415)

Waarom pik je nu deze eruit? Denk dat deze vogel niet heel erg opvalt naast bijv. deze:
 
http://waarneming.nl/waarneming/view/46024869 (http://waarneming.nl/waarneming/view/46024869)
http://waarneming.nl/waarneming/view/46024889 (http://waarneming.nl/waarneming/view/46024889)
http://waarneming.nl/waarneming/view/46025752 (http://waarneming.nl/waarneming/view/46025752)
http://waarneming.nl/waarneming/view/45923095 (http://waarneming.nl/waarneming/view/45923095)
 
Klassieke Taigas zijn het zeker niet, klassieke Toendras volgens mij ook niet. Daar kun je echter zeker anders over denken, zie bijv. afb 27 in onderstaand artikel:
 
http://limicola.de/fileadmin/user_upload/Dateien_Limicola/Limicola_Dokumente/BarthelG%C3%A4nseAnserLimicola1989.pdf (http://limicola.de/fileadmin/user_upload/Dateien_Limicola/Limicola_Dokumente/BarthelG%C3%A4nseAnserLimicola1989.pdf)
 
 
Lützen
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 16, 2010, 21:04:32 pm
Gezien de grijns en de kopvorm ga ik voor toendra.
Nek is wel wat richting taiga.

Theo
Titel: Re: rietgans, again...
Bericht door: Lucien Brinkhof op januari 16, 2010, 21:13:17 pm
Ik had gehoopt om ze samen op de foto te zetten met de ook aanwezige toendra's maar helaas. Ze waren duidelijk groter, bijna grauwe gans.
 
Lucien
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 16, 2010, 23:36:46 pm

Waarom pik je nu deze eruit?

Ik vond m er vrij goed uitzien, maar was gewoon benieuwd naar jullie mening... blijft lastige materie
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op januari 17, 2010, 00:09:13 am
Hoe langer ik naar deze foto's kijk (vooral die onderste) hoe meer ik het gevoel krijg dat ik gewoon naar een grauwe gans zit te kijken, alleen met een wat vreemde, afwijkende kleur aan de snavelbasis. Of is dat nou heel dom van me?
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 17, 2010, 08:55:43 am
Hoe langer ik naar deze foto's kijk (vooral die onderste) hoe meer ik het gevoel krijg dat ik gewoon naar een grauwe gans zit te kijken, alleen met een wat vreemde, afwijkende kleur aan de snavelbasis. Of is dat nou heel dom van me?
Ja
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 17, 2010, 09:19:04 am
als ik naar het schema in dit topic http://forum.waarneming.nl/smf/index.php?topic=98693.msg661069.html#msg661069 (http://forum.waarneming.nl/smf/index.php?topic=98693.msg661069.html#msg661069) kijk ziet-ie er toch gewoon goed uit? Ik bedoel dat niet zo eigenwijs als het misschien klinkt, maar ter leringh (ik ken mijn plaats, en die van Lützen heel goed in deze discussie)
maar goed, ik zieals plusjes vooral: lange nek, goede kopvorm, beschreven grootte, kleur (nauwelijks contrast kop en lichaam)... waar gaat het volgens jou/jullie dan mis?
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 17, 2010, 10:09:29 am
als ik naar het schema in dit topic http://forum.waarneming.nl/smf/index.php?topic=98693.msg661069.html#msg661069 (http://forum.waarneming.nl/smf/index.php?topic=98693.msg661069.html#msg661069) kijk ziet-ie er toch gewoon goed uit? Ik bedoel dat niet zo eigenwijs als het misschien klinkt, maar ter leringh (ik ken mijn plaats, en die van Lützen heel goed in deze discussie)
maar goed, ik zieals plusjes vooral: lange nek, goede kopvorm, beschreven grootte, kleur (nauwelijks contrast kop en lichaam)... waar gaat het volgens jou/jullie dan mis?

Hou me ten goede: ik spreek hier geen Taiga- of Toendraoordeel uit maar wil hier mee illustreren dat het besluit van de admins om zo'n oordeel op te schorten, zo slecht nog niet is. Immers lijkt deze vogel een aardige kandidaat voor Taiga vanwege zijn formaat en geheel oranje snavel. Maar de kopvorm klopt niet ("teveel" voorhoofd), de snavel is te dik (ook teveel 'grijns') en de linker vogel (qua formaat hetzelfde en vermoedelijk hetzelfde taxon) heeft dan weer een te donkere kop.
En zo kun je, als je o.a. de criteria uit dat schema wat strikt hanteert, wel aan de gang blijven: Taiga's die 100% aan die criteria voldoen zie je (bijna) nooit. Maar als je, net zoals ik gisteren, een paar 1000 rietganzen bekijkt zie je vele "Toendra's" waar ook, strikt genomen, een streepje aan mis is maar die ik toch geen Taiga's zou willen noemen omdat er daarvoor nňg meer streepjes aan mis zijn. Daarbij komt nog de soms verwarrende berichtgeving op dit forum van mensen die méér naar (riet)ganzen kijken dan ik.
 
 
Titel: Re: rietgans, again...
Bericht door: Christian op januari 17, 2010, 10:53:32 am
http://waarneming.nl/waarneming/view/45404104 (http://waarneming.nl/waarneming/view/45404104)

Ik ben heel erg benieuwd naar Lützens verklaring om deze vogels fabalis te noemen.
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 17, 2010, 11:00:57 am
http://waarneming.nl/waarneming/view/45404104 (http://waarneming.nl/waarneming/view/45404104)

Ik ben heel erg benieuwd naar Lützens verklaring om deze vogels fabalis te noemen.

ik ook, zeker gelet de afwijzing van de vogel van Lucien. Ik snap er steeds minder van geloof ik :-\
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 17, 2010, 11:06:34 am
- http://waarneming.nl/waarneming/view/46040725?_popup=1 (http://waarneming.nl/waarneming/view/46040725?_popup=1) lijkt mij een toendra met veel oranje
- http://waarneming.nl/waarneming/view/46024889?_popup=1 (http://waarneming.nl/waarneming/view/46024889?_popup=1) dit zie ik geloof ik ook niet gelijk waarom dit 100% fabalis is
- http://waarneming.nl/waarneming/view/45940206 (http://waarneming.nl/waarneming/view/45940206) hier meen ik ook wat minnetjes te zien (hoog voorhoofd, donkere kop, oké lange snavel, maar verder zie ik er niet zoveel van)
 
Dat zijn zomaar 3 voorbeelden van de eerste paar foto's.  Hoeveel waarnemingen zijn betrouwbaar? Zijn er een paar keiharde aan te wijzen waarover geen discussie is?
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 17, 2010, 13:44:06 pm
Inderdaad, ik zit er inmiddels redelijk in denk ik en heb goed geluisterd naar Albert de Jong.
Veel van deze vogels op deze fotoos noem ik in ieder geval Toendra.
Wat mijn plaats ook moge zijn.

Theo
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 17, 2010, 21:22:25 pm
ja maar... waarom zijn er dan zoveel geaccepteerde taiga's? en waarom zijn er zoveel vogelaars met zekere taiga's op hun lijst?
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 17, 2010, 21:35:12 pm
Er is geen enkele waarneming goedgekeurd door waarneming.nl. Zij wachten (helaas) af op harde kenmerken.
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 17, 2010, 21:43:05 pm
Er is geen enkele waarneming goedgekeurd door waarneming.nl. Zij wachten (helaas) af op harde kenmerken.
Oh... dat heb ik gemist, dat vind ik juist heel goed ipv helaas!
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 17, 2010, 21:56:05 pm
Vanwege die ook door jou al geconstateerde verwarring Gert t.a.v. dit determinatieprobleem hebben we besloten geen enkele 'rietgans' meer tot op soortniveau goed (of af) te keuren, totdat er klaarheid in deze materie komt. Het is feitelijk wachten op iemand die het probleem eens grondig aanpakt, al of niet via een digitaal 'artikel'. Het Witkopstaartmezen-artikel van Justin Jansen in DB is een goed voorbeeld van een enigszins vergelijkbaar probleem čn oplossing.
PS: Waarom het 'helaas' is dat wij (admins) wachten op een dergelijke oplossing is me een raadsel Jeroen......
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 17, 2010, 22:54:46 pm
Ik heb het al vaker gemeld: Er zijn gewoon overduidelijke Toendra's en soms taiga's die verkeerd gedetermineerd zijn door een gebrek aan kennis. deze mogen wat mij betreft toch (om het ennigzins zuiver te houden) worden voorzien van commentaar. Overigens kunnen halsbandwaarnemingen toch wel goedgekeurd worden?
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 17, 2010, 23:58:46 pm
Ik heb het al vaker gemeld: Er zijn gewoon overduidelijke Toendra's en soms taiga's die verkeerd gedetermineerd zijn door een gebrek aan kennis. deze mogen wat mij betreft toch (om het ennigzins zuiver te houden) worden voorzien van commentaar. Overigens kunnen halsbandwaarnemingen toch wel goedgekeurd worden?

En ik heb al vaker gezegd: wat de een (jij bijv.) "overduidelijke Toendra's" noemt, wil een ander nog wel eens Taiga noemen en andersom. Zolang die dappere beweringen niet kunnen worden gestaafd met algemeen aanvaarde, keiharde determinatiekenmerken, zien we nog even af van een oordeel.
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 18, 2010, 05:34:19 am
- http://waarneming.nl/waarneming/view/46040725?_popup=1 (http://waarneming.nl/waarneming/view/46040725?_popup=1) lijkt mij een toendra met veel oranje
- http://waarneming.nl/waarneming/view/46024889?_popup=1 (http://waarneming.nl/waarneming/view/46024889?_popup=1) dit zie ik geloof ik ook niet gelijk waarom dit 100% fabalis is
- http://waarneming.nl/waarneming/view/45940206 (http://waarneming.nl/waarneming/view/45940206) hier meen ik ook wat minnetjes te zien (hoog voorhoofd, donkere kop, oké lange snavel, maar verder zie ik er niet zoveel van)
 
Dat zijn zomaar 3 voorbeelden van de eerste paar foto's.  Hoeveel waarnemingen zijn betrouwbaar? Zijn er een paar keiharde aan te wijzen waarover geen discussie is?

Klopt, dit zijn wat mij betreft dan ook allemaal Toendra's. Het aantal betrouwbare waarnemingen van dit taxon kon inderdaad wel eens veel lager liggen dan menigeen denkt. Dit zijn, om antwoord te geven op je laatste vraag, een paar keiharde Taiga's waarover de rekkelijken en de preciezen het in elk geval 100% eens zijn: http://waarneming.nl/waarneming/view/45927620 (http://waarneming.nl/waarneming/view/45927620)
http://waarneming.nl/waarneming/view/41744063 (http://waarneming.nl/waarneming/view/41744063)
http://waarneming.nl/waarneming/view/41507310 (http://waarneming.nl/waarneming/view/41507310)
http://waarneming.nl/waarneming/view/41192453 (http://waarneming.nl/waarneming/view/41192453)
http://waarneming.nl/waarneming/view/3565835 (http://waarneming.nl/waarneming/view/3565835)
http://waarneming.nl/waarneming/view/3466442 (http://waarneming.nl/waarneming/view/3466442)
http://waarneming.nl/waarneming/view/3492248 (http://waarneming.nl/waarneming/view/3492248)
http://waarneming.nl/waarneming/view/1605480 (http://waarneming.nl/waarneming/view/1605480)
http://waarneming.nl/waarneming/view/1560753 (http://waarneming.nl/waarneming/view/1560753)
 
Overigens Frank, blijkbaar zijn nog niet alle admins op de hoogte van het besluit om geen oordeel meer uit te spreken:  http://waarneming.nl/waarneming/view/46062173 (http://waarneming.nl/waarneming/view/46062173)
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 18, 2010, 10:28:00 am
Klopt, dit zijn wat mij betreft dan ook allemaal Toendra's. Het aantal betrouwbare waarnemingen van dit taxon kon inderdaad wel eens veel lager liggen dan menigeen denkt. Dit zijn, om antwoord te geven op je laatste vraag, een paar keiharde Taiga's waarover de rekkelijken en de preciezen het in elk geval 100% eens zijn: http://waarneming.nl/waarneming/view/45927620 (http://waarneming.nl/waarneming/view/45927620)
[/color]http://waarneming.nl/waarneming/view/41744063 (http://waarneming.nl/waarneming/view/41744063)
[/color]http://waarneming.nl/waarneming/view/41507310 (http://waarneming.nl/waarneming/view/41507310)
[/color]http://waarneming.nl/waarneming/view/41192453 (http://waarneming.nl/waarneming/view/41192453)
[/color]http://waarneming.nl/waarneming/view/3565835 (http://waarneming.nl/waarneming/view/3565835)
[/color]http://waarneming.nl/waarneming/view/3466442 (http://waarneming.nl/waarneming/view/3466442)
[/color]http://waarneming.nl/waarneming/view/3492248 (http://waarneming.nl/waarneming/view/3492248)
[/color]http://waarneming.nl/waarneming/view/1605480 (http://waarneming.nl/waarneming/view/1605480)
[/color]http://waarneming.nl/waarneming/view/1560753 (http://waarneming.nl/waarneming/view/1560753)
 
Overigens Frank, blijkbaar zijn nog niet alle admins op de hoogte van het besluit om geen oordeel meer uit te spreken:  http://waarneming.nl/waarneming/view/46062173 (http://waarneming.nl/waarneming/view/46062173)
Sorry g.j.p. ik heb over diverse van de door jou als zekere Taiga's beschouwde vogels toch mijn twijfels. Zo duidelijk vindt ik sommige vogels niet. Er zijn ook diverse vogels die als losse vogel zijn waargenomen op plaatsen waarvan bekend is dat er vroeger met lokganzen is gewerkt (Eempolder, Zwarte Water). Toen de jacht met lokganzen werd verboden (ongeveer 20 jaar geleden) zijn veel van die vogels her en der losgelaten. Deze vogels en nakomelingen ervan kun je nog tegenkomen. Ook ontsnappen er wel eens lokganzen bij de ganzenvangers die nog steeds actief zijn voor het ringonderzoek. Lokganzen zijn het resultaat van generaties lang kweken. Je maakt bijvoorbeeld ook niet zomaar een lokgans van een aangeschoten gans, zoals sommigen vaak denken. Bij het kweken wordt gelet op het formaat. Hoe groter de gans hoe beter. Door deze selectie zijn steeds de grootste vogels overgebleven. Het is onmogelijk om op die vogels een etiket Taiga of Toendra te plakken, er is te lang mee gekweekt. Ik zou heel voorzichtig zijn met het "determineren" van losse vogels, zeker op vreemde plaatsen.
Titel: Re: rietgans, again...
Bericht door: marijn op januari 18, 2010, 12:28:43 pm
Hier een voorbeeld van zo'n grote lokgans: http://waarneming.nl/waarneming/view/3492248# (http://waarneming.nl/waarneming/view/3492248#)


Als ik Trinus goed begrijp kan ik het etiket Taiga daar ook beter afhalen.
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op januari 18, 2010, 12:31:14 pm
Wordt er dan ook geselecteerd op grootte en vorm van de snavel? Want die vind ik hier toch (ook) wel heel erg taiga.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 18, 2010, 15:21:01 pm
Een korte opsomming van feitelijke details;

-    De eerste fabalis is beschreven door John Latham in 1787 uit Groot Britannie. Deze vogel is niet meer bewaard gebleven, en er is geen beschrijving (pagina 297 van de Synopsis 1787 geeft alleen een Latijnse naam). De algemeenste rietgans is fabalis in Groot-Brittanie maar ook rossicus kan gevonden worden in Engeland. Dit lijkt al het eerste probleem te zijn, welke gans is fabalis genoemd? Dus de aanname van broedgebied etc is hiermee speculatief. Vaak werden bijzonder uitziende vogels geschoten dus wellicht was de vogel wel een rossicus?
Het interessantste zou zijn om een vogel welke we nu fabalis noemen, in Engeland te ringen en deze terug te volgen naar het broedgebied. Dan hebben we het eerste probleem getackeld.  Dan zullen in het broedgebied moeten gaan kijken wat zien we bij fabalis aan variatie. En hopen dat het de vogels betreft westelijk van de Oeral (Noorwegen, Zweden, Finland en Rusland).
-    De naam rossicus is door Sergei Aleksandrovich Buturlin gegeven in 1933 van een vogel welke afkomstig is van het Tamyr penninsula in Rusland. Dus het gaat dus om de ganzen populatie oostelijk van de Oeral.
Dit laatste geeft een houvast omdat het zich onomstotelijk handelt om een broedvogel. Het is dus cruciaal om te weten hoe groot de variatie hier is.

Ik denk als deze twee zaken inzichtelijk zijn, dat we dan weer eens verder moeten praten, er zijn nu te veel feitelijke onwaarheden.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 18, 2010, 16:38:44 pm
Het interessantste zou zijn om een vogel welke we nu fabalis noemen, in Engeland te ringen en deze terug te volgen naar het broedgebied. Dan hebben we het eerste probleem getackeld.  Dan zullen in het broedgebied moeten gaan kijken wat zien we bij fabalis aan variatie. En hopen dat het de vogels betreft westelijk van de Oeral (Noorwegen, Zweden, Finland en Rusland).
Dat onderzoek hoeft niet meer plaats te vinden, want die gegevens zijn er al. In Engeland/Schotland overwinteren slechts op 2 plaatsen "Rietganzen", namelijk een groep van tegenwoordig circa 250 vogels in Slamannan in Schotland en circa 150 vogels in de Yare Valley in Norfolk. Dus niet erg veel. Deze vogels worden door de Engelsen zelf Taiga Bean Geese genoemd. Er zijn ook gegevens over de herkomst. In juli 1987 werden in Västerbotten in Noord-Zweden 36 "Rietganzen" van een halsband voorzien. Deze vangst werd gedaan in een ruigroep van circa 300 exemplaren. Van de 36 geringde exemplaren doken maar liefst 22 op in de Yare Valley in Norfolk (toen overwinterden daar ongeveer 300 vogels). Omdat alle vogels van de Yare Valley als Taiga Rietganzen worden beschouwd lijkt het duidelijk dat de vogels die daar overwinteren uit Noord-Zweden komen, dus uit het bekende broedgebied van Anser (fabalis) fabalis. Ook geringde vogels die in Schotland werden afgelezen kwamen uit Zweden. Oftewel het is zeker dat alle Taiga Rietganzen die in Engeland/Schotland overwinteren uit Scandinavië komen.
Meer informatie over het voorkomen van de "Rietgans" in de UK van 1960-2000 te lezen in: http://www.wwt.org.uk/research/monitoring/pdf/Waterbird%20Review%20Series%20Bean%20Goose.pdf (http://www.wwt.org.uk/research/monitoring/pdf/Waterbird%20Review%20Series%20Bean%20Goose.pdf) en recente informatie op bladzijde 12 in: www.wwt.org.uk/research/monitoring/pdf/GooseNews8.pdf (http://www.wwt.org.uk/research/monitoring/pdf/GooseNews8.pdf)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 18, 2010, 17:07:43 pm
Het interessantste zou zijn om een vogel welke we nu fabalis noemen, in Engeland te ringen en deze terug te volgen naar het broedgebied. Dan hebben we het eerste probleem getackeld.  Dan zullen in het broedgebied moeten gaan kijken wat zien we bij fabalis aan variatie. En hopen dat het de vogels betreft westelijk van de Oeral (Noorwegen, Zweden, Finland en Rusland).
http://www.wwt.org.uk/research/monitoring/pdf/Waterbird%20Review%20Series%20Bean%20Goose.pdf (http://www.wwt.org.uk/research/monitoring/pdf/Waterbird%20Review%20Series%20Bean%20Goose.pdf) en recente informatie op bladzijde 12 in: www.wwt.org.uk/research/monitoring/pdf/GooseNews8.pdf (http://www.wwt.org.uk/research/monitoring/pdf/GooseNews8.pdf)
Dank Trinus, erg waardevolle linkjes. Veel is dus duidelijk over het herkomst gebied wat de Engelsen Taiga Bean Goose noemen. Dus het is dus zaak om in Västerbotten dus opnamen te gaan maken van de betreffende vogels, en zien hoever variabel dat deze zijn. Dus een probleem wat opgehelderd is, en wat nu nog parktisch moet worden uitgevoerd.
Tweede probleem blijft ook na het lezen van de eerste link op pagina 4. Hier staat het artikel van Berry 1939 aangehaald, en men twijfelde dus vroeger aan de indentiteit van de Rietganzen in Engeland, het zou zelfs mogelijk kunnen zijn dat Latham zelf een Kleine Rietgans in handen had.... (pas in 1834 beschreven). Ook noemt Berry de mogelijkheid dat rossicus algemener is/was dan fabalis. Wat had Latham in handen....... dat is eigenlijk mijn vraag....

Dus met opnames (er vanuitgaande dat Latham echt een fabalis in handen had) van variatie in vogels uit Västerbotten en Taymyr weten we ongeveer hoe groot de variatie is.
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 19, 2010, 06:34:43 am
Dus met opnames (er vanuitgaande dat Latham echt een fabalis in handen had) van variatie in vogels uit Västerbotten en Taymyr weten we ongeveer hoe groot de variatie is.

Nou ja, in elk geval weten we dan iets over de variatie binnen de Scandinavische populatie fabalis (t.o.v. rossicus). Een volgende stap zouden dan de meer oostelijke Taiga's (m.n. ten oosten van de Oeral, zeg maar het gebied dat voorheen werd toegeschreven aan 'johanseni') moeten zijn. En dan wordt het denk ik pas echt interessant... Overigens wel grappig: ik heb vaker foto's van de Britse vogels bekeken, en veel van deze beesten zou ik inderdaad 'klassieke Scandinaviërs' noemen. Blijkt dit allang aangetoond te zijn!
 
Om nog even terug te komen op Trinus' opmerking m.b.t. de door mij gelinkte 'duidelijke Taiga's': welke van deze vind jij dan niet duidelijk, Trinus? Inderdaad was het mij bekend dat de vogels van de Diemerpolder en de Eempolder zeker, en die van het Zwarte Water wellicht ook, voormalige lokganzen betroffen. Maar ik kan me eerlijk gezegd moeilijk voorstellen dat een rossicus als je er maar lang genoeg mee blijft doorkweken, geleidelijk aan de uit de literatuur bekende kenmerken van fabalis begint te vertonen! Zoals Guus terecht opmerkt: het formaat (dat lijkt me de enige voor ganzenflappers relevante grootheid) is zoals je weet niet het enige kenmerk van fabalis...
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 19, 2010, 12:20:31 pm
Om nog even terug te komen op Trinus' opmerking m.b.t. de door mij gelinkte 'duidelijke Taiga's': welke van deze vind jij dan niet duidelijk, Trinus? Inderdaad was het mij bekend dat de vogels van de Diemerpolder en de Eempolder zeker, en die van het Zwarte Water wellicht ook, voormalige lokganzen betroffen. Maar ik kan me eerlijk gezegd moeilijk voorstellen dat een rossicus als je er maar lang genoeg mee blijft doorkweken, geleidelijk aan de uit de literatuur bekende kenmerken van fabalis begint te vertonen! Zoals Guus terecht opmerkt: het formaat (dat lijkt me de enige voor ganzenflappers relevante grootheid) is zoals je weet niet het enige kenmerk van fabalis...
Een vogel waarvan ik een zekere Toendrarietgans zou maken is:
http://waarneming.nl/waarneming/view/41507310 (http://waarneming.nl/waarneming/view/41507310)
Vogels waar iets mee aan de hand is cq waar een luchtje aan zit zijn:
http://waarneming.nl/waarneming/view/41744063 (http://waarneming.nl/waarneming/view/41744063)
http://waarneming.nl/waarneming/view/41192453 (http://waarneming.nl/waarneming/view/41192453)
http://waarneming.nl/waarneming/view/3466442 (http://waarneming.nl/waarneming/view/3466442)
http://waarneming.nl/waarneming/view/3492248 (http://waarneming.nl/waarneming/view/3492248)
Deze laatste 4 vogels zijn m.i. van onduidelijke herkomst. Het is beter dergelijke vogels niet te betrekken in een discussie over Taiga of Toendra. Volgens mij worden deze Rietgansdiscussies te veel gevoerd op basis van losse exemplaren op rare plekken en zou het veel beter zijn dit te doen op basis van goede foto's van groepen Rietganzen en kan vanuit die situatie een veel betere discussie worden gevoerd.
Formaat is voor de ganzenjagers en tegenwoordig alleen nog maar de ganzenvangers voor een lokgans een belangrijk criterium. Als je de lokganzen van een ganzenvanger ziet, dan zie je bij de Rietganzen dat die erg groot zijn, veel groter dan de grootste wilde Rietganzen. Het zijn echt joekels. Omdat er bij sommige ganzenvangers misschien al meer dan 50 jaar wordt gekweekt met lokganzen en er vroeger waarschijnlijk ook met Toendra's werd gewerkt, men gebruikte wat voorradig was, kun je niet meer de kenmerken van die exemplaren zodanig vaststellen dat je tot een soort komt. Van ganzen waar selectief mee gekweekt is moet je niet proberen vast te stellen wat de (onder)soort is geweest. Er is te lang mee "geknoeid". Kolganzen die lokgans zijn verliezen ook hun buikstrepen, dus in gevangenschap is een gans anders dan in het wild. Omdat van veel vogels waar hier de discussies over gaan vrij duidelijk is dat de herkomst dubieus is moet je over die vogels eigenlijk ook niet discussieren.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 19, 2010, 12:33:26 pm
Voor de duidelijkheid nog enkele voorbeelden van het soort foto's waar ik op doel.
Toendrarietganzen: http://www.pbase.com/arieouwerkerk/image/72383275 (http://www.pbase.com/arieouwerkerk/image/72383275)
Taigarietganzen: http://www.pbase.com/image/109573294 (http://www.pbase.com/image/109573294)
Volgens mij kun je beter via dit soort foto's de discussies voeren dan op basis van foto's van losse exemplaren op ongewone plekken.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 19, 2010, 15:58:35 pm
Een belangrijk artikel over "Rietganzen" in Nederland is verschenen in Ardea in 1991. Dit was een artikel op basis van ringwerk in Nederland. Dit artikel is gratis te downloaden vanaf de site van Ardea via: http://nou.natuurinfo.nl/website/ardea/aanmelden.php?nr=341 (http://nou.natuurinfo.nl/website/ardea/aanmelden.php?nr=341) (even een e-mailadres invullen, maakt niet uit welke, en dan krijg je een pdf-file van het artikel op je scherm). Van de gevangen "Rietganzen" werd bepaald van welk type ze waren, type 1 of 2 (lees Taiga of Toendra). De terugmeldingen van dat ringwerk zijn aan de hand van die type-indeling geanalyseerd. Er staat in dat artikel ook een afbeelding met de type-aanduidingen. Kijk ook eens naar de frequentieverdeling per type. Die afbeelding heb ik zelf ook altijd gebruikt bij het ringen van ganzen in Zuidwest Friesland en dat ging altijd zonder problemen. Van elk individu kon met behulp van dat overzicht eenvoudig het type worden bepaald. De afbeelding stuur ik hierbij mee. Probeer in het veld of vanaf goede foto's ook eens uit of deze type-indeling handig kan zijn bij het vaststellen van de (onder)soort. 
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 19, 2010, 17:24:37 pm
Een vogel waarvan ik een zekere Toendrarietgans zou maken is:
http://waarneming.nl/waarneming/view/41507310 (http://waarneming.nl/waarneming/view/41507310)
Vogels waar iets mee aan de hand is cq waar een luchtje aan zit zijn:
http://waarneming.nl/waarneming/view/41744063 (http://waarneming.nl/waarneming/view/41744063)
http://waarneming.nl/waarneming/view/41192453 (http://waarneming.nl/waarneming/view/41192453)
http://waarneming.nl/waarneming/view/3466442 (http://waarneming.nl/waarneming/view/3466442)
http://waarneming.nl/waarneming/view/3492248 (http://waarneming.nl/waarneming/view/3492248)
Deze laatste 4 vogels zijn m.i. van onduidelijke herkomst. Het is beter dergelijke vogels niet te betrekken in een discussie over Taiga of Toendra. Volgens mij worden deze Rietgansdiscussies te veel gevoerd op basis van losse exemplaren op rare plekken en zou het veel beter zijn dit te doen op basis van goede foto's van groepen Rietganzen en kan vanuit die situatie een veel betere discussie worden gevoerd.
Formaat is voor de ganzenjagers en tegenwoordig alleen nog maar de ganzenvangers voor een lokgans een belangrijk criterium. Als je de lokganzen van een ganzenvanger ziet, dan zie je bij de Rietganzen dat die erg groot zijn, veel groter dan de grootste wilde Rietganzen. Het zijn echt joekels. Omdat er bij sommige ganzenvangers misschien al meer dan 50 jaar wordt gekweekt met lokganzen en er vroeger waarschijnlijk ook met Toendra's werd gewerkt, men gebruikte wat voorradig was, kun je niet meer de kenmerken van die exemplaren zodanig vaststellen dat je tot een soort komt. Van ganzen waar selectief mee gekweekt is moet je niet proberen vast te stellen wat de (onder)soort is geweest. Er is te lang mee "geknoeid". Kolganzen die lokgans zijn verliezen ook hun buikstrepen, dus in gevangenschap is een gans anders dan in het wild. Omdat van veel vogels waar hier de discussies over gaan vrij duidelijk is dat de herkomst dubieus is moet je over die vogels eigenlijk ook niet discussieren.

Trinus,
 
Dank voor je uitvoerige reactie. Toch nog een paar vragen en opmerkingen.
- Leuk om te weten dat je van die vogel van Lützen een Toendra zou maken, maar waaróm? Dit lijkt me een prima type 1D, om met Burgers et al te spreken. Let op de zeer lange hals, het platte voorhoofd, het bijzonder langgerekte kop-snavelprofiel en de mooie, reeds aan de basis platte bek zonder uitbuiging in de ondersnavel en bijbehorende 'grijns'.
- Wat je zegt over de lokganzen, oké, discussiëren we niet meer over. De foto's van Enno Ebels tonen overigens voor zover bekend wel degelijk een wilde vogel, de door velen (ook door mij) getwitchte vogel van polder Boekhorst.
- Natuurlijk, ik ben het met je eens dat het veel beter is om te discussiëren over groepen dan over losse exemplaren. Zelf voer ik dan ook uitsluitend Taiga's op deze site in als ik ervan overtuigd ben dat de héle familie Taiga's betreft óf het met zekerheid om solitaire vogels gaat. Anders krijg je de situatie dat bij foto's als deze: http://waarneming.nl/foto/view/1002623 (http://waarneming.nl/foto/view/1002623), de achterste vogel een Taiga en de voorste een Toendra genoemd wordt. Hoewel ik vermoed dat het in de praktijk vaak zo gaat, is dit pertinent onjuist: deze foto toont een paartje, waarvan de achterste vogel de gent is. Het punt is in Nederland echter dat groepen Taiga's zoals het door jou getoonde groepje prachtige Scandinaviërs gewoonweg flink zeldzaam zijn. En dus breken we ons het hoofd over allerlei dubieuze beesten waar minder eenvoudig een etiket op de plakken valt.
- Het artikel van Burgers et al is mij bekend. Sterker nog: het door jou gequote plaatje heb ik lang geleden reeds uitgeprint en in m'n notitieboekje geplakt... Alleen krijg ik op basis van ervaringen in het veld er meer en meer mijn twijfels over of de in dit artikel genoemde verhoudingen tussen de snavelpatronen (daterend uit begin jaren negentig, zo uit m'n hoofd) anno nog accuraat zijn. Type 2A, die volgens Burgers et al niet of nauwelijks bestaat, kom ik niet zelden tegen. De op basis van structuur door mij als vermoedelijke type 1 beschouwde beesten zijn daarentegen vaker zwart- dan geelbekken.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 19, 2010, 17:42:08 pm
Pieter-Geert en Trinus, kennen jullie bijvoorbeeld op de website http://www.vogelsindekempen.nl/ dan onder onderzoek/oproep en dan onder oproep rietganzen-determinatie, hier staan 209 rietganzen. Laat mooi wat variatie zijn. Zou zo'n Zweedse groep wel weer eens willen zien. 
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op januari 19, 2010, 19:29:25 pm
Ik heb geen tijd om uitgebreid te reageren, maar wil de volgende opmerkingen maken:

Het meeste recente artikel in het rietganzenonderzoek, dat van Ruokonen e.a. 2008 laat significante verschillen in de biometrie zien tussen fabalis en rossicus. Het gaat echter om enkele millimeters (ik weer uit mijn hoofd helaas niet welke verschillen precies). Ik heb eruit opgemaakt dat het een hachelijke kwestie is om in het veld met die gegevens te werken. Op basis van het artikel is de split van 1996 zelfs discutabel. Het is wat dat betreft niet verwonderlijk dat we er niet uit komen.

Volgens mij is wel duidelijk dat we te maken hebben met een cline, vergelijkbaar met het verhaal intermedius-fuscus. (De vergelijking met het witkopstaartmezenverhaal vind ik minder toepasselijk, omdat we daar inmiddels sowieso 1 hard kenmerk voor hebben.) Alleen heb je bij ganzen niets aan ruipatronen. Wel wat aan ringen in het gebied waar de vogels met zekerheid tot het taxon fabalis behoren. Aangezien dat de laatste jaren nauwelijks gedaan is, hebben we daar dus voorlopig niets aan.

Ik ga weer verder studeren op een wel opgelost probleem...
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 19, 2010, 20:42:14 pm
dusseh... lumpen die handel?
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 19, 2010, 20:57:27 pm
dusseh... lumpen die handel?

Ha, we gaan weer terug naar de zwaar verouderde 'good old Kist' uit 1972! Dat boek rept alleen over Rietgans (Anser fabalis) en stelt zelfs: 'Kleine Rietgans wordt in het algemeen als een ondersoort van Rietgans beschouwd'.
 
Toch wonderlijk hoor. Tien ŕ vijftien jaar geleden was je toch wel een matige vogelaar als je Toendrarietgans en Taigarietgans niet uit elkaar kon houden.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 19, 2010, 21:25:25 pm

De vergelijking met het witkopstaartmezenverhaal vind ik minder toepasselijk, omdat we daar inmiddels sowieso 1 hard kenmerk voor hebben.

Het gaat om de situatie die daar aan vooraf ging Albert. Vóór de resultaten van het onderzoek van Justin c.s. bekend waren, werd er van alles geroepen over de 'harde' kenmerken van caudatus (snavelgrootte, tekening tertials en/of armpennen, kleur bovenzijde en flanken, enz.), net als nu bij de 'rietganzen'. Nu kunnen we met het artikel van Justin in de hand naar hartelust onze oordelen over al die valse witkoppen vellen. En in díe zin zouden we graag over een qua intentie vergelijkbaar artikel beschikken om eindelijk eens die rietganzen te lijf te gaan........ 8)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 19, 2010, 22:10:53 pm
ja maar... waarom zijn er dan zoveel geaccepteerde taiga's? en waarom zijn er zoveel vogelaars met zekere taiga's op hun lijst?
hoi Gert,
 
Heel simpel hoor. Bijna twee jaar geleden heb ik dit nog aan de orde gesteld tijdens een ganzenbijeenkomt in Arnhem. En volgens Sovon is het onderscheid tussen Toendrarietgans en Taigarietgans heel simpel. En in hun jaarlijkse watervogelrapporten wordt al sedert jaar en dag alleen maar gesproken over hetzij Taigarietgans (momenteel door Sovon Anser fabalis genoemd) hetzij Toendrarietgans (momenteel door Sovon Anser serrirostris genoemd). Kijk maar op pagina 88-91 van het meest recente rapport over de watervogeltellingen (en in de diverse tabellen en bijlagen). Het rapport staat gewoon online op http://www.sovon.nl/pdf/Mon2007-03Wavo2005-2006.pdf (http://www.sovon.nl/pdf/Mon2007-03Wavo2005-2006.pdf)
 
Volgens het rapport werden in Nederland in de winter 2005/06 maximaal 3800 Taigarietganzen geteld (met aangegeven dat de soort niet door alle tellers wordt herkend en dat in de piektijd niet alle gebieden werden geteld). Hoogste aantal was 1977 Taigarietganzen in januari 2006 in het Bargerveen.
 
Bij Toendrarietgans ging het in de winter van 2005/06 om maximaal 178.000 vogels die in Nederland zaten.
 
Sovon vindt het dus geen enkel probleem om Taigarietganzen te 'accepteren' en voert dus -kennelijk- een andere koers dan waarneming.nl. Sterker: je wordt als teller toch wel als matige / ouderwetse vogelaar beschouwd als je stug blijft doorgaan met het tellen van Rietganzen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 19, 2010, 22:15:31 pm
Hmm... Volgens mij zit er genoeg Sovon-bloed op wrn.nl om dat daar eens aan de kaak te stellen. Of beschikt Sovon over een straight forward identificatie-artikel dat de toch ook niet minne vogelaars op wrn.nl vooralsnog over het hoofd hebben gezien ...?
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op januari 19, 2010, 22:17:09 pm
@ Klaas. Inderdaad, mits het CSNA de split terugdraait, wat niet snel zal gebeuren. Overigens is de split op soortniveau in verschillende publicaties na '96 nog niet terug te vinden. En met het criterium grote rietgans met een vooral gele snavel was het 'vroegah' waarschijnlijk makkelijk werken ja ;-).

@ Frank, oké, ik begrijp het. Dat heb je als je te snel leest  :-X .

Edit: Sovon krijgt veel telgegevens van Leo van den Bergh. Over zijn publicaties is in het langlopende topic over het rietganzenprobleem meer te vinden.
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 19, 2010, 22:32:19 pm
Bovendien kun je met gedegen onderzoek aan deze gansjes wellicht een bedankje krijgen in de volgende uitgave van de Collins! Wij als meeuwenfreaks zijn daar in ieder geval erg trots op.

Theo
Titel: Re: rietgans, again...
Bericht door: marijn op januari 19, 2010, 22:46:58 pm
Dat recente artikel van Ruokonen et al. (2008) (http://dx.doi.org/10.1016/j.ympev.2008.04.038) zie ik zelf nu pas. Apart dat er nog amper eerder aan gerefereerd is. In het kort: ze hebben dna- en morfologisch onderzoek gedaan aan 199 rietganzen van de 5 bekende taxa (incl. Kleine) in of afkomstig uit bekende broedgebieden en komen oa tot de conclusie dat Taiga en Toendra geen soortstatus verdienen (maar middendorffi wel). En oa ook dat het enige significante morfologische verschil tussen fabalis en rossicus de hoogte van de grijnsplek is, nl. gemiddeld 1,5 mm (rossicus 7,29 mm vs. fabalis 5,8 mm). Tussen de andere taxa zijn meer significante verschillen te vinden.
Men heeft als morfologische kenmerken overigens alleen snavellengte, snavelhoogte, nagellengte, grijnsplekhoogte en 'kleurhoogte' (mate van hoeveelheid oranje/roze) gemeten. Hiervan konden alleen de eerste vier in de statistische analyses meegenomen worden (kleur bleek niet normaal verdeeld).
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 19, 2010, 22:48:10 pm
Ach, de Baltische Mantelmeeuw is in bepaalde Nederlandse kringen ook een tijdje een soort geweest (Larus fuscus). De in Nederland broedende Kleine Mantelmeeuwen werden toen Larus graellsii genoemd. En zo worden ze in mijn ANWB-gids (editie 2000) ook genoemd. Tegenwoordig hoor je hier niemand meer over. En de naam 'Gewone Kokmeeuw' heeft het niet veel langer dan enkele maanden uitgehouden.
 
Theo, zeer gefeliciteerd hiermee. En volkomen terecht, want jullie werk is de enige juiste optie.
 
Het is inderdaad broodnodig dat die hele 'rietganzenzaak' definitief goed wordt uitgebeend. En natuurlijk kan dat alleen maar met vogels waarvan je 100% zeker weet waar ze geboren zijn. Gewoon door grootschalig nestjonge 'rietganzen' uit alle mogelijke broedgebieden te voorzien van individueel herkenbare halsbanden (adulten op het nest vangen en van halsbanden voorzien kan natuurlijk ook).
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 20, 2010, 11:12:48 am
@ Klaas. Inderdaad, mits het CSNA de split terugdraait, wat niet snel zal gebeuren.
hoi Albert,
 
De CSNA mag dan wel ooit besloten hebben dat Rietgans in twee soorten verdeeld moet worden (Taigarietgans en Toendrarietgans), maar dat betekent natuurlijk niet dat 'iedereen' klakkeloos achter de CDNA/CSNA c.s. aanloopt.
 
 
(1): De samenvatting van het al eerder aangehaalde artikel 'Taxonomy of the bean goose–pink-footed goose' in het wetenschappelijke tijdschrift "Molecular Phylogenetics and Evolution" begint met de zin: "The Bean Goose Anser fabalis and the Pink-footed Goose A. brachyrhynchus breed in the tundra and taiga zones of Eurasia and eastern Greenland."
 
Het artikel is geschreven door en namens M. Ruokonen (Department of Biology, University of Oulu , P.O. Box 3000, Oulu 90014, Finland), K. Litvin (Bird Ringing Centre of Russia, IEE RAS, Vavilova, 34, Moscow, Russia) en T. Aarvak (Norwegian Ornithological Society, Sandgata 30 B, N-7012 Trondheim, Norway) en is in 2008 gepubliceerd.

Al deze wetenschappers, instituten & de redactie van het tijdschrift gaan dus uit van één soort Rietgans met de wetenschappelijke naam Anser fabalis.


(2): De Nederlandse website voor het invoeren van aflezingen van halsbanden, pootringen etc. van ganzen (http://www.geese.org/Ganzen/Index.jsp (http://www.geese.org/Ganzen/Index.jsp)) stelt: "In Europa komen twee ondersoorten van de Rietgans voor, de Taigarietgans, die vooral in strenge winters opduikt (‘geelbekken’ noemen de ganzenvangers hen), en de Toendrarietgans (‘zwartbekken’). Soms worden deze twee ondersoorten als aparte soorten beschouwd, maar daar is nog niet iedereen het over eens."
Dus ook hier één soort Rietgans.


(3): De WWT (Wetland and Wildfowl Trust, http://www.wwt.org.uk/research/monitoring/species/bean.asp (http://www.wwt.org.uk/research/monitoring/species/bean.asp)) stelt: "Most authorities currently recognize five races of Bean Goose (e.g. Wetlands International 2006 (http://www.wwt.org.uk/research/monitoring/references.asp#WI_2006)). These fall into two groups: those breeding in tundra regions and those breeding in forested taiga areas to the south. There is overlap between these races, however, and the taxonomy of Bean Geese is still uncertain. Two races (A. f. fabalis and A. f. rossicus)are found in the Western Palearctic and both occur in Britain."
Dus ook hier één soort Rietgans (Anser fabalis).
 
 
(4): het dikke standaardwerk 'Goose Populations of the Western Palearctic', uitgegeven in 1999 door Wetlands International (Madsen, Cracknell & Fox, editors) gaat ook uit van één soort Rietgans (Anser fabalis). Hoofdstuk 1 gaat over Taiga Bean Goose (Anser fabalis fabalis), hoofdstuk 2 over Tundra Bean Goose (Anser fabalis rossicus).
 
 
En zo zijn er vast nog wel meer voorbeelden te vinden.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 20, 2010, 14:10:27 pm
En zonet was ik nog even aan het kijken op de website van Wetlands International (http://www.wetlands.org/ (http://www.wetlands.org/)).
 
Kortgeleden (2009) bleek een nieuw rapport uitgekomen te zijn: Status of waterbirds in Asia, results of the Asian Waterbird Census: 1987-2007 (Authors: Li, Z.W.D., Bloem, A., Delany S., Martakis G. and Quintero J. O. , Date of Publication: 2009 , ISBN: 978-90-5882-012-9). Gratis down te loaden via http://www.wetlands.org/LinkClick.aspx?fileticket=OtArom9ugao%3d&tabid=56 (http://www.wetlands.org/LinkClick.aspx?fileticket=OtArom9ugao%3d&tabid=56)
 
Op pagina 123 staat:
 
"Bean Goose Anser fabalis
1% = 800 (middendorffi, East Asia), 700 (serrirostris, East Asia). The figure of 800 was used as the 1% criterion for the identification of internationally important sites, because of the difficulty in separating these two subspecies whose non-breeding grounds almost completely overlap. Six sites reported more than 20,000 individuals and in total 63 sites in the Republic of Korea, China and Japan met the 1% criterion. The peak count in East Asia for 2002-2004 was 141,167 birds at 83 sites, and 282,317 birds at 129 sites for 2005-2007. In 2005 only 204,074 individuals were recorded. The figure suggests that the current population estimate of the species needs to be reviewed."

 
Dus ook hier gewoon (nog? / weer?) sprake van één soort Rietgans, Anser fabalis. Op pagina 124 staat nog een waslijst van gebieden met hoge aantallen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: ruud_altenburg op januari 20, 2010, 15:44:37 pm
Klaas, rapporten geven doorgaans niet de meest betrouwbare informatie over taxonomie. Los daarvan: volgens mij worden Taiga- en Toendrarietgans alleen in Nederland als aparte soorten beschouwd. Afgaande op een persoonlijke mededeling van een van de leden is die beslissing destijds niet eens unaniem door de CSNA genomen.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 20, 2010, 18:21:10 pm
hoi Ruud,
 
Erg leuk die 'inside' informatie. Ik heb bewust ook een wetenschappelijk artikel genoemd. Er zijn vast nog wel >10 anderen te vinden. En een aantal organisaties met een website (want dan kan iedereen het zelf nakijken). En m.b.t de aangehaalde andere rapporten kun je deels twisten of het een (wetenschappelijk?) rapport is of een boek. En een flinke boom opzetten over wat 'wetenschappelijk' is en wat niet. 
 
Maar volgens mij zijn het vaak totaal gescheiden werelden:
-biologen / onderzoekers die vanuit een ecologische bril naar populaties etc. kijken en -vaak- de soortsnaam niet / nauwelijks belangrijk vinden.
-vogelaars die graag zoveel mogelijk ergens een naam op plakken, lijsten van soorten bijhouden (hoe meer hoe beter) etc.
 
En het zijn niet alleen Nederlandse vogelaars die Taiga- en Toendrarietgans als twee soorten beschouwen.
Duitse vogelaars (http://www.club300.de/ (http://www.club300.de/)):
WaldsaatgansTaiga Bean GooseAnser fabalis
TundrasaatgansTundra Bean GooseAnser serrirostris

Maar deense vogelaars (http://www.netfugl.dk/dklist.php (http://www.netfugl.dk/dklist.php)) de Britse BTO (http://blx1.bto.org/birdfacts/results/bob1570.htm (http://blx1.bto.org/birdfacts/results/bob1570.htm)) en Oostenrijkse vogelaars (http://www.club300.at/birds/aut (http://www.club300.at/birds/aut)) hebben het over één soort, de Rietgans (Anser fabalis).
 
Groetjes, Klaasoose Anser fabalis   [Latham, 1787]
 
 
Titel: Re: rietgans, again...
Bericht door: Gerben Mensink op januari 20, 2010, 19:01:32 pm
Helemaal eens met Gert. Lumpen die hap. Allemaal min een  ;D
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 20, 2010, 22:40:22 pm
nav de dodaars/jonge fuut hier ook maar een poll toegevoegd...
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 20, 2010, 22:53:56 pm
Kenmerken zijn wel duidelijk genoeg, maar de overlap. ik zou zeggen, niet te determineren.
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 20, 2010, 22:56:08 pm
Kenmerken zijn wel duidelijk genoeg, maar de overlap. ik zou zeggen, niet te determineren.
speciaal voor jou veranderd in 'rietgans spec.' (om wat voor reden dan ook)
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 20, 2010, 22:57:47 pm
nav de dodaars/jonge fuut hier ook maar een poll toegevoegd...

en ook een beetje om Frank te plagen natuurlijk, meeste stemmen gelden, dit wordt het einde van de taiga als zelfstandig taxon  ;)   :D
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 20, 2010, 23:01:24 pm
nav de dodaars/jonge fuut hier ook maar een poll toegevoegd...

en ook een beetje om Frank te plagen natuurlijk, meeste stemmen gelden, dit wordt het einde van de taiga als zelfstandig taxon  ;)   :D

Rňtjongen............
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 21, 2010, 09:22:51 am
Rňtjongen............

ik van jou  ;D
Titel: Re: rietgans, again...
Bericht door: marijn op januari 21, 2010, 09:57:29 am
volgens mij worden Taiga- en Toendrarietgans alleen in Nederland als aparte soorten beschouwd.

In Amerika ook sinds 2007 (AOU (http://www.aou.org/checklist/suppl/AOU_checklist_suppl_48.pdf)), en op basis daarvan doet het IOC (http://www.worldbirdnames.org/n-waterfowl.html) (Gill & Wright) dit ook...
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 21, 2010, 10:28:03 am
Dat recente artikel van Ruokonen et al. (2008) (http://dx.doi.org/10.1016/j.ympev.2008.04.038) zie ik zelf nu pas. Apart dat er nog amper eerder aan gerefereerd is. In het kort: ze hebben dna- en morfologisch onderzoek gedaan aan 199 rietganzen van de 5 bekende taxa (incl. Kleine) in of afkomstig uit bekende broedgebieden en komen oa tot de conclusie dat Taiga en Toendra geen soortstatus verdienen (maar middendorffi wel). En oa ook dat het enige significante morfologische verschil tussen fabalis en rossicus de hoogte van de grijnsplek is, nl. gemiddeld 1,5 mm (rossicus 7,29 mm vs. fabalis 5,8 mm). Tussen de andere taxa zijn meer significante verschillen te vinden.
Men heeft als morfologische kenmerken overigens alleen snavellengte, snavelhoogte, nagellengte, grijnsplekhoogte en 'kleurhoogte' (mate van hoeveelheid oranje/roze) gemeten. Hiervan konden alleen de eerste vier in de statistische analyses meegenomen worden (kleur bleek niet normaal verdeeld).

Wellicht is er gedegen onderzoek nodig naar nieuwe kenmerken?
Bij de libellen is dat op enkele fronten ook gelukt, simpel door scherp waarnemen en veel fotoos naast elkaar leggen.
Weten we alles al over de ondervleugel, staart (groenl versus kol), vleugelprojectie, veerpatronen van bijv dekveren en tertials, tekening op de bovendelen....
Soms moet je gewoon veel beter kijken en naar andere kenmerken kijken dan de reeds bekende.
Hier in de Biesbosch hebben we een groep die goed af te kijken is op minder dan 100 meter. Daar kun je wel wat mee uitvogelen. Overigens, mijn meldingen van Taiga (ja, ik doe gewoon mee met stringen) zijn van vogels waarvan ik het hele huidige arsenaal aan kenmerken kon controleren...
Wellicht is dat niet meer genoeg. Wel vindt ik buiten de vage kenmerken om, de grijns een opvallend verschil geven in gezichtsuitdrukking. Het geeft in combinatie met de snavelvorm, snavellengte, voorhoofd en kopkleur een ander gevoel dan bij langsnavelige Toendra's.

Theo
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 21, 2010, 10:53:06 am
Iets bekend over eventuele verschillen in vocalisaties?
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 21, 2010, 11:28:55 am
Dat recente artikel van Ruokonen et al. (2008) (http://dx.doi.org/10.1016/j.ympev.2008.04.038) zie ik zelf nu pas. Apart dat er nog amper eerder aan gerefereerd is. In het kort: ze hebben dna- en morfologisch onderzoek gedaan aan 199 rietganzen van de 5 bekende taxa (incl. Kleine) in of afkomstig uit bekende broedgebieden en komen oa tot de conclusie dat Taiga en Toendra geen soortstatus verdienen (maar middendorffi wel). En oa ook dat het enige significante morfologische verschil tussen fabalis en rossicus de hoogte van de grijnsplek is, nl. gemiddeld 1,5 mm (rossicus 7,29 mm vs. fabalis 5,8 mm). Tussen de andere taxa zijn meer significante verschillen te vinden.
Men heeft als morfologische kenmerken overigens alleen snavellengte, snavelhoogte, nagellengte, grijnsplekhoogte en 'kleurhoogte' (mate van hoeveelheid oranje/roze) gemeten. Hiervan konden alleen de eerste vier in de statistische analyses meegenomen worden (kleur bleek niet normaal verdeeld).

Wellicht is er gedegen onderzoek nodig naar nieuwe kenmerken?
Bij de libellen is dat op enkele fronten ook gelukt, simpel door scherp waarnemen en veel fotoos naast elkaar leggen.
Weten we alles al over de ondervleugel, staart (groenl versus kol), vleugelprojectie, veerpatronen van bijv dekveren en tertials, tekening op de bovendelen....
Soms moet je gewoon veel beter kijken en naar andere kenmerken kijken dan de reeds bekende.
Hier in de Biesbosch hebben we een groep die goed af te kijken is op minder dan 100 meter. Daar kun je wel wat mee uitvogelen. Overigens, mijn meldingen van Taiga (ja, ik doe gewoon mee met stringen) zijn van vogels waarvan ik het hele huidige arsenaal aan kenmerken kon controleren...
Wellicht is dat niet meer genoeg. Wel vindt ik buiten de vage kenmerken om, de grijns een opvallend verschil geven in gezichtsuitdrukking. Het geeft in combinatie met de snavelvorm, snavellengte, voorhoofd en kopkleur een ander gevoel dan bij langsnavelige Toendra's.

Theo

Goe bezig jongen....... 8)
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 21, 2010, 12:41:54 pm
zolang hij op de nedelandse lijst gesplit staat zal ik hem voor mijn lijstje dank ook allebei proberen te vinden met de info waar het tot nog toe altijd mee gedaan is.
ik kies hier voor toendra door de rond kop met de kleine snavel.
 
het liefst had ik natuurlijk gewoon rietgans gekozen maarja dat zou 1 minder op het lijstje betekenen terwijl anderen em wel rekenen dus ja of iedereen gewoon rietgans of iedereen splitten vind ik :angel:
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 21, 2010, 13:09:02 pm
Nou, het grootste probleem is dat ze allebei in NL overwinteren, tenminste, die kans is best wel groot.
We zullen er dus echt iets mee moeten.

Theo
Titel: Re: rietgans, again...
Bericht door: jvdlaan op januari 21, 2010, 13:49:39 pm
Of Taiga en Toendra nu aparte soorten zijn of niet lijkt me volstrekt irrelevant.
Immers het gaat hier op waarneming.nl om het verzamelen en archiveren van waarnemingen. Het lumpen van deze twee taxa lijkt me ongewenst in die zin dat dan niet meer bekend wordt waar de respectievelijke populaties overwinteren. In het kader van natuurbeschermin e.d lijkt mij dat dringend gewenst om die informatie zo goed en kwaad als het gaat te blijven verzamelen.
Mijn stokpaardje in deze is de Kaapverdische Purperreiger: omdat dit taxon geen 'officiele' soortstatus heeft (officieel in die zin dat BirdLife International dit taxon niet als biologische soort erkent), worden er geen beschermingsmaatregelen genomen of geld uitgetrokken voor onderzoek. Gevolg is dat dit taxon zeer ernstig bedreigd is en het nu het zeldzaamste  reigertaxon van de wereld is met ca 20 vogels.
 
Belangrijk is het dus met deze rietganzen dat we wel alles wat mogelijk is in het werk blijven stellen om het voorkomen van beide populaties in kaart te brengen.
Titel: Re: rietgans, again...
Bericht door: HPM op januari 21, 2010, 14:27:42 pm
Het probleem zoals ik het begrijp is dat ze in het veld niet betrouwbaar van elkaar zijn te
onderscheiden, zodat de kans op foute determinaties groot is. Dat betekent ook dat de
populaties hier in het overwinteringsgebied in het veld niet met zekerheid zijn te herkennen,
(vooropgesteld dat er uiterljke verschillen zijn tussen de verschillende populaties), zodat
samenvoegen geen invloed zal hebben op het onderscheiden van de verschillende populaties.
De broedpopulaties worden bepaald door het gebied waar ze broeden. Herkenning van die
populaties kan hier alleen met zekerheid door het aflezen van ringen en (mogelijk) door het
vergelijken van DNA. Als Nederland tegen de stroom in meent dat er verschillen zijn, zullen
die verschillen hard gemaakt moeten worden.

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op januari 21, 2010, 15:25:34 pm
Mijn stokpaardje in deze is de Kaapverdische Purperreiger: omdat dit taxon geen 'officiele' soortstatus heeft (officieel in die zin dat BirdLife International dit taxon niet als biologische soort erkent), worden er geen beschermingsmaatregelen genomen of geld uitgetrokken voor onderzoek. Gevolg is dat dit taxon zeer ernstig bedreigd is en het nu het zeldzaamste  reigertaxon van de wereld is met ca 20 vogels.


Hier is een artikel over het effect van taxonomie op bescherming (ik heb wel pdf):
http://www.sciencedirect.com/science/article/B6V5X-4X24C49-1/2/2db11c97187f6fdd3e1f48b8ba44fc29


Geen ijzersterk stuk, maar misschien is dit effect wel wat kleiner dan je al snel aanneemt....
Titel: Re: rietgans, again...
Bericht door: HPM op januari 21, 2010, 15:44:46 pm
Mijn stokpaardje in deze is de Kaapverdische Purperreiger: omdat dit taxon geen 'officiele' soortstatus heeft (officieel in die zin dat BirdLife International dit taxon niet als biologische soort erkent), worden er geen beschermingsmaatregelen genomen of geld uitgetrokken voor onderzoek. Gevolg is dat dit taxon zeer ernstig bedreigd is en het nu het zeldzaamste  reigertaxon van de wereld is met ca 20 vogels.
Hier is een artikel over het effect van taxonomie op bescherming (ik heb wel pdf):
http://www.sciencedirect.com/science/article/B6V5X-4X24C49-1/2/2db11c97187f6fdd3e1f48b8ba44fc29 (http://www.sciencedirect.com/science/article/B6V5X-4X24C49-1/2/2db11c97187f6fdd3e1f48b8ba44fc29)


Geen ijzersterk stuk, maar misschien is dit effect wel wat kleiner dan je al snel aanneemt....

Hier is het helemaal online te lezen
http://www.slideshare.net/madmanor24/morrison-etal-2009-how-taxonomy-impacts-conservation

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 21, 2010, 15:45:23 pm
@Herman, 14:27:42: Omdat waarnemingen van rieten s.l. nu niet beoordeeld worden, kan ik me voorstellen dat de verleiding bestaat/groter wordt om elke riet als 'rietgans spec.' in te voeren. Wat Jan denk ik (ook) bedoelt, is dat het zinvol is rieten wel zoveel als mogelijk op naam te (trachten te) brengen - en uiteraard met beschrijving/foto's in te voeren. Als je kort door de bocht beesten met kleine snavel/korte nek als (aldanniet onzekere) toendra invoert, en beesten met 'zwanenkop'/lange nek als (dito) taiga, kun je later met die waarnemingen hoe dan ook meer dan als je nu een enorme berg 'rietgans spec.' gaat creeren ....
Titel: Re: rietgans, again...
Bericht door: jvdlaan op januari 21, 2010, 16:04:24 pm
@Herman, 14:27:42: Omdat waarnemingen van rieten s.l. nu niet beoordeeld worden, kan ik me voorstellen dat de verleiding bestaat/groter wordt om elke riet als 'rietgans spec.' in te voeren. Wat Jan denk ik (ook) bedoelt, is dat het zinvol is rieten wel zoveel als mogelijk op naam te (trachten te) brengen - en uiteraard met beschrijving/foto's in te voeren. Als je kort door de bocht beesten met kleine snavel/korte nek als (aldanniet onzekere) toendra invoert, en beesten met 'zwanenkop'/lange nek als (dito) taiga, kun je later met die waarnemingen hoe dan ook meer dan als je nu een enorme berg 'rietgans spec.' gaat creeren ....

Correct!
Titel: Re: rietgans, again...
Bericht door: HPM op januari 21, 2010, 16:09:19 pm
@Herman, 14:27:42: Omdat waarnemingen van rieten s.l. nu niet beoordeeld worden, kan ik me voorstellen dat de verleiding bestaat/groter wordt om elke riet als 'rietgans spec.' in te voeren. Wat Jan denk ik (ook) bedoelt, is dat het zinvol is rieten wel zoveel als mogelijk op naam te (trachten te) brengen - en uiteraard met beschrijving/foto's in te voeren. Als je kort door de bocht beesten met kleine snavel/korte nek als (aldanniet onzekere) toendra invoert, en beesten met 'zwanenkop'/lange nek als (dito) taiga, kun je later met die waarnemingen hoe dan ook meer dan als je nu een enorme berg 'rietgans spec.' gaat creeren ....

Als er maar een soort is kunnen ze natuurlijk alleen maar als dat worden ingevoerd. Dat is dan
A. fabalis, die dan geen 'Rietgans spec' heet, maar 'Rietgans'. Als er goede reden is om ze wel
ondersoorten te onderscheiden moeten die natuurlijk apart zijn in te voeren, maar ook dan moet
de determinatie op betrouwbare gronden gebeuren. Wat dat betreft maakt het geen verschil of
het soorten of ondersoorten zijn.
Zolang er twijfel is over soort/ondersoort is het goed om te blijven proberen de twee vormen te
onderscheiden, en zover dat onderscheid op goede gronden is gebeurd moet de informatie
uiteraard bij de waarneming bewaard blijven.

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 21, 2010, 16:20:16 pm
Zolang er twijfel is over soort/ondersoort is het goed om te blijven proberen de twee vormen te
onderscheiden, en zover dat onderscheid op goede gronden is gebeurd moet de informatie
uiteraard bij de waarneming bewaard blijven.

--
Groeten, Herman van der Meer
:duim:
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 21, 2010, 17:37:14 pm
Maar de uitersten zijn toch wel degelijk herkenbaar? Als we voor beide soorten/ondersoorten/vormen/whatever o.b.v. eerdere determinatieliteratuur een set kenmerken benoemen, en dan (alleen) vogels die aan al deze kenmerken voldoen taiga danwel toendra noemen (oftewel een voorbeeld aan Theo nemen en dan ook voor 'extreme toendra's'), dan zijn we al weer wat verder dan nu toch?
Titel: Re: rietgans, again...
Bericht door: Dylan op januari 22, 2010, 10:20:39 am
Foto uit de oude doos (en oude camera), 30 nov 2003 in de OVP:
Ik heb nog meer foto's, maar van mindere kwaliteit. Met moderne middelen misschien op te krikken.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 22, 2010, 10:31:39 am
Foto uit de oude doos (en oude camera), 30 nov 2003 in de OVP:
Welke vogel bedoel je, en over welke soort heb je het?
Titel: Re: rietgans, again...
Bericht door: Dylan op januari 22, 2010, 11:03:58 am
Excuus, was inderdaad onvolledig. Was ondertussen aan het spelen met fotoprogramma om er (wat voor mij toen was) een duidelijke Toendra uit te halen. Deze foto (flink geschoven met belichting) kwam eruit:
Snavel, donkere kop, korte nek, was voor mij toen doorslaggevend. Maar ben direct benieuwd naar wat anderen ervan vinden.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 22, 2010, 12:15:10 pm
Het probleem zoals ik het begrijp is dat ze in het veld niet betrouwbaar van elkaar zijn te onderscheiden, zodat de kans op foute determinaties groot is. Dat betekent ook dat de populaties hier in het overwinteringsgebied in het veld niet met zekerheid zijn te herkennen, (vooropgesteld dat er uiterljke verschillen zijn tussen de verschillende populaties), zodat samenvoegen geen invloed zal hebben op het onderscheiden van de verschillende populaties.
De broedpopulaties worden bepaald door het gebied waar ze broeden. Herkenning van die populaties kan hier alleen met zekerheid door het aflezen van ringen en (mogelijk) door het vergelijken van DNA. Als Nederland tegen de stroom in meent dat er verschillen zijn, zullen die verschillen hard gemaakt moeten worden.--
Groeten, Herman van der Meer

Beste Herman,
 
In ieder geval is al een tijdje geen overeenstemming over hoe algemeen Taigarietgans op dit moment (cq in pakweg de laatste tien jaar) in Nederland voorkomt. En dat staat los van de status van Taigarietgans (soort of ondersoort).
 
(1): op de site van Dutch Birding http://www.dutchbirding.nl/news.php?id=9 (http://www.dutchbirding.nl/news.php?id=9) staat een bijdrage waaruit duidelijk naar voren komt dat Taigarietgans in normale winters niet of nauwelijks in Nederland voorkomt.
 
(2): op de site van Sovon http://www.sovon.nl/default.asp?id=135 (http://www.sovon.nl/default.asp?id=135) kun je een hele rij watervogelrapporten downloaden / lezen. Jaarlijkse overzichtsrapportages van watervogeltellingen (inclusief ganzen) van de seizoenen 2001/02, 2002/03, 2003/04, 2004/05, 2005/06 en 2006/07. Met duidelijke telresultaten die uitwijzen dat er jaarlijks zeker enkele duizenden Taigarietganzen in Nederland overwinteren. Met verspreidingskaartjes en al. Dus iedereen zou deze groepen zo op moeten kunnen zoeken. Met bijvoorbeeld seizoensmaxima van 5200 in 2001/02, 4900 in 2002/03 en 4200 in 2004/05. Misschien heb je deze rapporten ook allemaal zelf wel in de kast staan (iedere watervogelteller krijgt namelijk altijd een exemplaar thuis).
 
Gezien de discussie (die trouwens al zeker twee jaar speelt) is het erg jammer dat er op de komende landelijke 'ganzen & zwanendag' (30 januari a.s., zie ander topic voor details) geen aandacht hieraan wordt besteed.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: HPM op januari 22, 2010, 14:29:52 pm
Maar Klaas, het probleem zit hem in de determinatie in het veld. Dat betekent dat de aantallen
in de watervogelrapporten wat dat betreft waarschijnlijk ook niet betrouwbaar zijn.

--
Groeten, Herman van der Meer



Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 22, 2010, 15:17:23 pm
Maar Klaas, het probleem zit hem in de determinatie in het veld. Dat betekent dat de aantallen in de watervogelrapporten wat dat betreft waarschijnlijk ook niet betrouwbaar zijn.
--Groeten, Herman van der Meer
Beste Herman,
 
Ja. Daar heb je volkomen gelijk aan. En ik neig zelf ook sterk tot deze mening.
 
Maar..... Vanuit de optiek van de tellers & Sovon is er niets aan de hand m.b.t. de determinatie in het veld. Taigarietganzen zijn Taigarietganzen, als zodanig worden ze geteld en doorgegeven en als zodanig staan ze in de verschillende watervogelrapporten. Lees de verschillende hoofdstukjes maar na. En Sovon gaat toch jaar in jaar uit in officiële rapporten (want kijk maar wie allemaal wel niet auteur is en namens & voor wie deze rapporten allemaal wel niet worden uitgegeven) geen (uitgebreide) hoofdstukken schrijven over een soort / ondersoort waarover twijfel bestaat of hij wel goed is gedetermineerd?
 
Het lijkt mij in ieder geval hoog tijd dat hier wel wat overeenstemming over komt. En het kan ook heel goed dat besloten wordt dat een deel van de Rietganzen gewoon -voorlopig- niet op naam is te brengen. Kan ook als argument worden gebruikt voor 'lumpen'. Want wat moet je als teller aan met soorten die je in het veld niet / nauwelijks uit elkaar kunt houden (zie bv ook Amerikaanse Zilvermeeuw in Nederland versus Zilvermeeuw)? Ik check ook niet elke Zilvermeeuw tijdens een wadvogeltelling op Schiermonnikoog. En daar zal vast ook wel eens een Pontische Meeuw tussen zitten.
 
 
Zonet ook het meest nieuwe nummer van De Levende Natuur uit de brievenbus gehaald. Een themanummer over ganzen. Erg goed, maar m.b.t. naamgeving verwarrend.
 
Berend Voslamber (Sovon), Henk van der Jeugd (Vogeltrekstation) en Kees Koffijberg (Sovon) gebruiken in het ene artikel (Broedende ganzen in Nederland) de naam 'Toendrarietgans Anser serrirostris' (pagina 41), maar in een ander artikel (Doortrekkende en overwinterende ganzen in Nederland, met in totaal 9 auteurs geschreven inclusief hunzelf) de naam 'Taigarietgans Anser fabalis fabalis' en Toendrarietgans Anser fabalis rossicus' (pagina 3). En een recent wintermaximum in Nederland van Taigarietgans wordt gesteld op 4.000.
 
Begrijp jij het nog? De soort 'Rietgans Anser fabalis' overwintert in Nederland en de soort 'Toendrarietgans Anser serrirostris' broedt in Nederland?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 22, 2010, 18:44:00 pm
Excuus, was inderdaad onvolledig. Was ondertussen aan het spelen met fotoprogramma om er (wat voor mij toen was) een duidelijke Toendra uit te halen. Deze foto (flink geschoven met belichting) kwam eruit:
Snavel, donkere kop, korte nek, was voor mij toen doorslaggevend. Maar ben direct benieuwd naar wat anderen ervan vinden.

Waarmee maar weer eens bewezen is dat een eerste indruk niet zelden de juiste is...
Inderdaad een volstrekt duidelijke Toendrarietgans (A.s. rossicus), geen enkel kenmerk dat wijst op het tegendeel.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 22, 2010, 23:07:28 pm
Pieter-Geert en Trinus, kennen jullie bijvoorbeeld op de website http://www.vogelsindekempen.nl/ (http://www.vogelsindekempen.nl/) dan onder onderzoek/oproep en dan onder oproep rietganzen-determinatie, hier staan 209 rietganzen. Laat mooi wat variatie zijn. Zou zo'n Zweedse groep wel weer eens willen zien.
Ja, die website ken ik. Het was al weer een tijdje geleden. Ik heb ze nu ook weer even vluchtig bekeken en zo op het eerste gezicht lijken het (nagenoeg) allemaal Toendrarietganzen.

De afgelopen dagen ontdekte ik een artikel van de Duitse Rietganskenner Thomas Heinicke in het zogenaamde Monitoring Rundschreiben van afgelopen herfst (te downloaden via: http://www.dda-web.de/downloads/texts/dda_rundschreiben/rundschreiben_2_09_grau_standard.pdf (http://www.dda-web.de/downloads/texts/dda_rundschreiben/rundschreiben_2_09_grau_standard.pdf)). Het artikel gaat over de trekbewegingen van Rietganzen in Midden-Europa in 2008/2009. Hierin staan een aantal interessante zaken vermeld. Zo staat er onder andere in vermeld dat er in Nederland, Duitsland en Rusland (Kolguyev) in de jaren 2006-2009 totaal 556 Rietganzen zijn geringd (517 rossicus en 39 fabalis). Van de 556 Rietganzen zijn er 238 in Duitsland geringd en 30 in Rusland. Hieruit kan worden afgeleid dat er dan in Nederland 288 Rietganzen moeten zijn geringd. Van de 39 "fabalissen" zijn er 38 tegelijk geringd in de herfst 2007 in het Oderdal langs de Duits-Poolse grens. Van 1 fabalis blijkt uit het artikel niet waar deze is geringd. Van de 288 in Nederland geringde Rietganzen in 2006-2009 zijn er dus minimaal 287 exemplaren een rossicus en hooguit 1 exemplaar een fabalis, oftewel helemaal of nagenoeg 100% Toendrarietgans. Dat is heel wat anders dan het eerder door mij aangehaalde artikel van Burgers et al uit 1991. In dat artikel werd over de jaren 1963-1986 vermeld dat van 7347 exemplaren 2792 tot type 1 behoorden (fabalis) en 4555 tot type 2 (rossicus), oftewel 38% fabalis en 62% rossicus.
 
Het lijkt er dus gewoon op dat fabalis geruisloos uit Nederland is verdwenen. Dit wordt bevestigd door het stukje van Heinicke. Daarin wordt vermeld dat de Scandinavische broedvogels tegenwoordig in Midden- en Zuid-Zweden overwinteren en dat de Russische broedvogels hoofdzakelijk in NO-Duitsland en NW-Polen overwinteren. Verder staat er nog bij dat de traditie van overwintering in Nederland, zoals die nog in de jaren 70 en 80 bestond, klaarblijkelijk in de eerste helft van de jaren 90 is opgehouden te bestaan. Alles in dit stukje van Heinicke komt overeen met de ervaringen, zoals die in dit forum regelmatig aan de orde zijn geweest, namelijk dat niemand recente ervaring lijkt te hebben met een fatsoenlijke groep "echte" Taigarietganzen in Nederland. Het lijkt er op dat in Nederland uitsluitend nog Toendrarietganzen overwinteren en dat daarin iedereen zich suf zoekt naar Taigarietganzen die er niet meer zijn. Gevolg daarvan is dat Toendrarietganzen die enigzins kenmerken hebben van Taigarietganzen al snel als Taigarietgans worden bestempeld. Intussen wordt regelmatig opgemerkt dat steeds meer Taigarietganzen die in Nederland zouden overwinteren donkerdere snavels hebben in vergelijking met enkele tientallen jaren geleden. Dat is op zich natuurlijk niet erg aannemelijk, dat in zo korte tijd een fysisch kenmerk zo sterk verandert. In het eerder aangehaalde stuk van Ruokonen uit 2008 bestaat ook een aanzienlijk deel van het materiaal uit vogels die 100 jaar geleden zijn verzameld. Dat wordt in ieder geval nog actueel genoeg geacht om er nu over te publiceren.
 
Het enige wat niet in dit hele verhaal van verschuiving van overwinteringsgebieden past zijn de resultaten van de SOVON-tellingen uit recente winters. Uit deze tellingen zou blijken dat er nog duizenden Taigarietganzen in Nederland zouden overwinteren. Zou dat wel kloppen? Of worden in de gebieden waar vroeger traditioneel Taigarietganzen zaten nu de Toendrarietganzen voor Taigarietganzen uitgemaakt? Iets om uit te zoeken.
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 22, 2010, 23:27:13 pm
Blijft over na dit heldere verhaal dat 'mijn' taiga's dus zeer waarschijnlijk extreme toendra's zijn, wellicht afwijkend door een andere herkomst binnen toendraland...
Wel raar dat er in het zuid-oosten van NL nog zoveel taiga's zitten...
Al helemaal als je leest dat de Taigaringen destijds in Engeland werden afgelezen, je verwacht dan toch dat ze in Noord-Holland zitten...
Theo
Titel: Re: rietgans, again...
Bericht door: HPM op januari 22, 2010, 23:37:18 pm
Na het verhaal van Trinus moet je je gaan afvragen of er werkelijk zo veel in het ZO zitten
of dat het op misidentificatie berust.

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 23, 2010, 00:24:12 am
Na het verhaal van Trinus moet je je gaan afvragen of er werkelijk zo veel in het ZO zitten
of dat het op misidentificatie berust.

--
Groeten, Herman van der Meer

Dat vraag ik me al een aantal jaren af: ik woon (en vogel) in het ZO en zie nauwelijks (nog) 'echte' Taiga's........evenmin als de meeste van mijn vogelmaten.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 23, 2010, 11:12:17 am
Trinus, heel erg bedankt voor deze link! Een erg verhelderend artikel. En ook mooi dat DDA dergelijke nieuwsbrieven gewoon online zet. Maar ik begin er langzaam aan steeds minder van te snappen.
 
Enerzijds zoals hier en op de site van Dutch Birding (http://www.dutchbirding.nl/news.php?id=9 (http://www.dutchbirding.nl/news.php?id=9)) staan een hele rij mensen die beweren dat ze momenteel maar niet / nooit / moeizaam een Taigarietgans in Nederland kunnen vinden.
 
Anderzijds zijn er de jaarlijkse watervogelrapportages van Sovon waaruit naar voren komt dat er jaarlijks minimaal enige duizenden Taigarietganzen in Nederland overwinteren. Even voor de duidelijkheid de seizoensmaxima van de afgelopen zes seizoenen:
2001/02: 5200 Taigarietganzen in Nederland (geteld aantal; tabel 8.1 watervogelrapport 2005/06 pag 63).
2002/03: 4900 Taigarietganzen in Nederland (geteld aantal; tabel 8.1 watervogelrapport 2005/06 pag 63).
2003/04: 3600 Taigarietganzen in Nederland (geteld aantal; tabel 8.1 watervogelrapport 2005/06 pag 63).
2004/05: 4200 Taigarietganzen in Nederland (geteld aantal; tabel 8.1 watervogelrapport 2005/06 pag 63).
2005/06: 3800 Taigarietganzen in Nederland (geteld aantal; tabel 8.1 watervogelrapport 2005/06 pag 63).
2006/07: 4000 Taigarietganzen in Nederland (schatting; tabel 6.2 watervogelrapport 2006/07 pag 43).
 
Opvallend genoeg is het meest recente rapport (2006/07) opeens wat vager over de juiste getallen (pag 57) en worden vragen gesteld over de juistheid van de determinatie. En een verspreidingskaart ontbreekt (maar is wel in de andere rapporten te vinden).
 
En gister gister verscheen opeens ook een stukje hierover op de site van Sovon (http://www.sovon.nl/default.asp?id=406#krant1320 (http://www.sovon.nl/default.asp?id=406#krant1320)):
"Een Dutch Birding knuppeltje in het rietganzenhok Sinds de laatste rietganzensplit, alweer meer dan 10 jaar geleden, begonnen de 'preciezen' onder de twitchers zich af te vragen of ze Taigarietgans ooit echt bewust en correct hadden gedetermineerd. De 'rekkelijken' daarentegen redeneerden dat ze in hun leven zo veel rietganzen hadden gezien, ook in provincies waarvan werd beweerd dat Taigagans vaak voorkwam, dat ze de split als een 'armchair tick' opvatten. De 'rekkelijken' zijn nog steeds duidelijk in de meerderheid en sommigen van hen beweren zelfs dat ze de soort iedere winter tegenkomen. Dat laatste wordt zelden of nooit gestaafd door foto's, dus daar mogen vraagtekens bij worden geplaatst. Dat geldt overigens ook voor de beweringen van inventariseerders die jaarlijks nog honderden exemplaren registreren. Zo begint een artikel van Arnoud van den Berg over het (weinig) voorkomen van Taigarietganzen in Nederland. Lees het hel[/color]e verhaal (met foto's)op de Dutch Birding-site http://www.dutchbirding.nl/news.php?id=9 (http://www.dutchbirding.nl/news.php?id=9)[/color][/color]
[/color]
Ik als eenvoudige leek, begrijp er langzaam aan helemaal niets meer van. Wie heeft nu gelijk? Het rapport van 2005/06 is bijvoorbeeld geschreven door 16 verschillende auteurs (9 auteurs met een naam en 7 anderen die behoren tot de auteur 'Sovon ganzen- en zwanenwerkgroep').[/color]
Groetjes, Klaas[/color]

PS: RARE DINGEN OVER COLOR EN FONT ZITTEN IN EEN ONZICHTBAAR ONDERWATERSCHERM!!! ONMOGELIJK OM ALS DIGIBEET DEZE TE VERWIJDEREN; EXCUSES!!!!!!!!![/font]
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op januari 23, 2010, 11:22:29 am
Ik vind het juist wel duidelijk: ook SOVON begint zich af te vragen of al die grote aantallen overwinterende taiga's die worden gerapporteerd, wel kloppen. En dat lijkt me een goede zaak. Hopelijk lopen alle organisaties en vogelaars wat dat betreft binnenkort weer een beetje in de pas.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 23, 2010, 12:56:39 pm
Standaard check ik elke groep rietganzen erg uitvoerig en kon deze winter nog nergens iets vinden wat ook maar enigsinds een goeie kandidaat taigarietgans ging (volgens de kenmerken die de meeste mensen nu gebruiken. lange snavel, veel oranje op de snavel, lange nek, fors formaat, dunne ondersnavel, lichte- en langgerekte kop) tot ik van de week in het fochteloërveen ineens een groep zag waarbij ik bij 1 op de 10 ganzen dacht hee dat zou ook wel eens een taiga kunnen zijn (daarvan ook 1 op de foto gezet bij mijn waarnemingen....zie hieronder) lijkt mij een type 1b rietgans.(je ziet zelfs nog iets van een witte rand aan de snavelbasis) rechts daarnaast lijkt mij (wederom op basis van wat nu gehanteerd wordt) een duidelijke type 2c toendrarietgans.
 
wat is jullie mening?
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 23, 2010, 13:13:38 pm
Trinus, heel erg bedankt voor deze link! Een erg verhelderend artikel. En ook mooi dat DDA dergelijke nieuwsbrieven gewoon online zet. Maar ik begin er langzaam aan steeds minder van te snappen.
-----
Opvallend genoeg is het meest recente rapport (2006/07) opeens wat vager over de juiste getallen (pag 57) en worden vragen gesteld over de juistheid van de determinatie. En een verspreidingskaart ontbreekt (maar is wel in de andere rapporten te vinden).

Hoi Klaas (en anderen),
Misschien komen we nu zo langzamerhand in de fase waarin we met z'n allen wel beter gaan begrijpen "hoe het zit". Uit het SOVON-verslag van de ganzentellingen over 2006/2007 blijkt inderdaad dat daar inmiddels ook wordt getwijfeld aan de juistheid van de determinaties (had ik tot nu toe overheen gelezen). Het lijkt er op dat slechts enkele ganzentellers steevast Taigarietganzen door blijven geven uit hun gebied. Belangrijk om dat eens goed uit te zoeken en met een definitief oordeel hierover te komen. Het stukje over de Taigarietgans in het SOVON-rapport is volgens mij geschreven door Leo van den Bergh. Hij is de soortspecialist van de "Rietganzen" binnen de Ganzen- en Zwanenwerkgroep Nederland. Als hij al twijfelt over de determinatie betekent dit ook dat hij ze zelf niet meer tegenkomt op zijn tochten door Nederland. Dat zegt ook wel iets. Alles op een rijtje gezet kunnen we bijna alleen maar tot de conclusie komen dat de Taigarietganzen in ieder geval in normale winters niet meer in Nederland zitten of hooguit een handvol.
 
Mijn conclusie is dat Taigarietganzen er nog steeds hetzelfde uitzien als 20 jaar geleden, namelijk zo: http://www.pbase.com/image/109573294 (http://www.pbase.com/image/109573294)
De vogels die tegenwoordig in Nederland voor Taigarietganzen worden uitgemaakt zijn in werkelijkheid voor het overgrote deel vogels:
- waar een luchtje aan zit (voormalige lokgans, parkgans e.d.);
- Toendrarietganzen die nog het meest op Taigarietganzen lijken.
 
Er zullen vast in Nederland af en toe nog wel eens een paar Taigarietganzen te zien zijn. Voor een zekere determinatie moet volgens mij vooral gezocht worden naar familiegroepjes. Een aanzienlijk deel van de vogels in een ganzenpopulatie maakt deel uit van een familie, vaak paartjes met jongen. Waar naar gezocht moet worden is naar families waar alle vogels er uitzien als Taigarietganzen. Pas dan kan met zekerheid gezegd worden dat het inderdaad Taigarietganzen zijn.
 
Ik heb nog even alle foto's van de winter 2009/2010 bekeken die bij de waarnemingen van Taigarietganzen op waarneming.nl staan. Het overgrote deel daarvan zijn m.i. gewoon Toendrarietganzen, van de meeste vraag ik mij af op grond waarvan de waarnemer überhaupt het idee heeft dat het een Taigarietgans zou kunnen zijn. Er zijn 3 waarnemingen waar het lijkt alsof op de foto een familiegroepje Taigarietganzen staat afgebeeld, namelijk:
6 januari 2010 Vlijmensch Ven: http://waarneming.nl/waarneming/view/45927620 (http://waarneming.nl/waarneming/view/45927620)
17 januari 2010 Brummen: http://waarneming.nl/waarneming/view/46053519 (http://waarneming.nl/waarneming/view/46053519)
21 januari 2010 Kraaijenbergsche Plassen: http://waarneming.nl/waarneming/view/46105694 (http://waarneming.nl/waarneming/view/46105694)
Alleen in het veld is te zien welke vogels bij elkaar horen, dus een foto alleen zegt niet alles.
 
Nu de Taigarietgans blijkbaar niet meer in Nederland zit en deze soort dus tussen de Toendrarietganzen niet meer te vinden is zeggen sommigen dat deze helemaal niet meer bestaat. Dat is natuurlijk te kort door de bocht. De Taigarietgans bestaat nog steeds, zit alleen niet meer in Nederland, maar wel daarbuiten. Lumpen op grond van alleen de situatie in Nederland is uiteraard niet juist.   
 
 
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 23, 2010, 13:59:24 pm
Na de eerdere info van oa Albert dat Taiga's steeds noordelijker gaan overwinteren, het gebrek aan bewijs van de aantallen in het oosten en het stukje (2 zelfs) op de DB site van Arnoud, 1 van onze ganzenexperts, denk ik dat Taiga echt een zeldzaam ding is en dat er erg veel arm chair-tickers eens goed mogen nadenken waar zij dan een echte Taiga hebben gezien. Het wordt steeds duidelijker; Taiga is geen weggevertje of twijfelgeval, er zijn alleen maar erg duidelijke!! Dat is nou wel duidelijk.
Dus, alleen gevallen met keiharde fotoos die goed detail laten zien, zijn nog geloofwaardig, de rest is zoals sommigen van ons al dachten binnen de variatie van Toendra.

Theo
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 23, 2010, 14:04:40 pm
oké! Alle waarnemingen op onzeker, behalve hele hele harde. Ik ben benieuwd hoeveel er hier dan over blijven, een handje vol misschien? Hier gaan een paar admins veel vrienden maken ;)
 
maar even nog, nav de hele discussie deze: http://waarneming.nl/waarneming/view/45927620?_popup=1 (http://waarneming.nl/waarneming/view/45927620?_popup=1) ook niet goed genoeg? z-o NL? Wel veel tot voor kort harde kenmerken te zien toch?
Titel: Re: rietgans, again...
Bericht door: jvdlaan op januari 23, 2010, 14:44:03 pm
Nu de Taigarietgans blijkbaar niet meer in Nederland zit en deze soortdus tussen de Toendrarietganzen niet meer te vinden is zeggen sommigendat deze helemaal niet meer bestaat. Dat is natuurlijk te kort door debocht. De Taigarietgans bestaat nog steeds, zit alleen niet meer inNederland, maar wel daarbuiten. Lumpen op grond van alleen de situatiein Nederland is uiteraard niet juist.   

Bovenstaande citaat van Trinus vat m.i het probleem het beste samen.

confession mode on
Jan (begint zich eigenlijk een beetje te schamen en baseert zijn lijst vnml op het zg massale voorkomen in 1979 en een vogel die al jaren bij Diemen zit) * confession mod off
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 23, 2010, 14:50:46 pm
ik heb m voor alsnog van mijn lijst gehaald, maar wel heel benieuwd naar een blik van de kenners op de foto's bij waarnemingen, zoals die ik in mijn vorige post heb gezet. Als ik eerdere posts goed begrijp valt die er dus ook af? Net als alle andere meldingen van de afgelopen jaren
Titel: Re: rietgans, again...
Bericht door: redmar_woudstra op januari 23, 2010, 15:41:22 pm
Citaat
During the winter the major part of the Taiga Bean Geese are found in south Sweden, Poland, Germany, Denmark and formerly also the Netherlands. Smaller numbers are still to be found in Great Britain during winter.

Ik weet niet of deze site al eens eerder is aangehaald, het is afkomstig van een site via de universiteit van Lund: http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/TAIGA-BEAN.htm (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/TAIGA-BEAN.htm). Wel opvallend vind ik dat het Verenigd Koninkrijk nog genoemd wordt als overwinteringsgebied, volgens wikipedia gaat het om de Yare Valley in Norfolk en Avon Valley in Schotland. Toendrarietgans haalt in de VK nog geen fractie van de aantallen hier te lande en staat te boek als "rare and irregular". Via deze site (http://www.birdsofbritain.co.uk/bird-guide/bean-goose.asp (http://www.birdsofbritain.co.uk/bird-guide/bean-goose.asp)) kwam ik op de volgende informatie over de fabilis van Yare Valley. Hier is in ieder geval hard bewijs voor een Zweedse afkomst.
Citaat

 The enigma began lifting one winter when to everyone's surprise 22 bean geese appeared in the valley carrying neck bands. It was discovered these were from a group of 36 captured in a moulting flock of 300 non-breeding or failed breeding geese at a remote central Swedish locality during July 1987. Banded examples have continued arriving here ever since.

Nog een ander interessant project zijn de sattelite-tracked rietganzen (twee fabilis, twee rossicus) vanuit Zweden: http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/SATTELIT-GEESE.htm (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/SATTELIT-GEESE.htm). Nu is de site sinds juni 2009 niet meer geüpdate, ik ben benieuwd of ze hebben kunnen traceren waar de vogels de winter hebben doorgebracht. Nu komen de kaartjes niet verder dan een migratie van enkele 100en kilometers, van Lapland /Finnmark naar de Botnische Golf rond Umea en Lulea.
 
Deze (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/UME-GEESE.htm (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/UME-GEESE.htm)) observaties van in Zweden geringde (nekbanden) ganzen onderschrijft dat veel vogels in Zweden overwinteren: terugmeldingen beperken zich geheel (voor zover ik begrijp) tot Zweden. Vogels lijken met name in Zuid-Zweden (Skane) te zitten.
 
Heeft iemand contact gezocht met meneer Leif Nilsson van de ecologie afdeling van de LU? Wellicht dat hij nog wat aanvullende informatie heeft, wellicht over de satteliet-ganzen. Ben erg benieuwd waar die de winter hebben doorgebracht.
 
Tot slot het verslag van een ganzentelling, winter 2008-2009 (http://www.zoo.ekol.lu.se/waterfowl/ANDINV/ANDRAP/Waterfowl_Report_08-09.pdf (http://www.zoo.ekol.lu.se/waterfowl/ANDINV/ANDRAP/Waterfowl_Report_08-09.pdf)). Ook dit rapport geeft aan dat veel rietganzen in Skane overwinteren. In oktober bevinden de vogels zich vooral in midden-Zweden, met name in de "landskappen" Uppland, Södermanland en Västmanland. In januari zijn de grootste concentraties te vinden in Skane en westelijk Blekinge. Mijn Zweeds is niet zo best, maar de Engelse samenvatting vermeldt het volgende:
Citaat

 In October the majority of the taiga Bean Geese are
probably staging in Sweden. In October 2008 as in October 2007, more than 60000 Bean Geese
were counted in the country, i.e. more than in the preceeding years. Swedish data together with
data from Germany and Poland indicate that the total population of the sub species has
decreased to about 70000 – 90000 or even less.

Wellicht herhaal ik nu allerlei informatie die door anderen (Trinus, Klaas, etc.) al eerder is aangehaald. Anderszijds lijkt met mij gezien de ontwikkelingen niet onverstandig dat er een stevige analyse komt naar het voorkomen van fabilis in Nederland. Wellicht is het in de toekomst een soort die, gezien de lastige determinatie, in aanmerking kan komen voor behandeling door de CDNA? Mijn taiga gaat in ieder geval op onzeker, misschien zelfs wel op toendra.
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 23, 2010, 16:41:00 pm
oké! Alle waarnemingen op onzeker, behalve hele hele harde. Ik ben benieuwd hoeveel er hier dan over blijven, een handje vol misschien? Hier gaan een paar admins veel vrienden maken ;)
 
maar even nog, nav de hele discussie deze: http://waarneming.nl/waarneming/view/45927620?_popup=1 (http://waarneming.nl/waarneming/view/45927620?_popup=1) ook niet goed genoeg? z-o NL? Wel veel tot voor kort harde kenmerken te zien toch?

Gert, lees het laatste stukje van Trinus nog 's, vooral daar waar hij 3 gevallen noemt die goede kandidaten voor echte Taiga's zouden kunnen zijn (o.a. omdat er een (familie-)groepje gelijkaardige vogels op staat).... 8)
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 23, 2010, 16:43:57 pm
Standaard check ik elke groep rietganzen erg uitvoerig en kon deze winter nog nergens iets vinden wat ook maar enigsinds een goeie kandidaat taigarietgans ging (volgens de kenmerken die de meeste mensen nu gebruiken. lange snavel, veel oranje op de snavel, lange nek, fors formaat, dunne ondersnavel, lichte- en langgerekte kop) tot ik van de week in het fochteloërveen ineens een groep zag waarbij ik bij 1 op de 10 ganzen dacht hee dat zou ook wel eens een taiga kunnen zijn (daarvan ook 1 op de foto gezet bij mijn waarnemingen....zie hieronder) lijkt mij een type 1b rietgans.(je ziet zelfs nog iets van een witte rand aan de snavelbasis) rechts daarnaast lijkt mij (wederom op basis van wat nu gehanteerd wordt) een duidelijke type 2c toendrarietgans.
 
wat is jullie mening?

Als je deze vogel vergelijkt met de Zweedse foto die Trinus aanhaalt en waarop klassieke Taiga's staan, valt-ie meteen door de mand: een Toendra met een oranje bek.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 23, 2010, 16:56:18 pm
ik heb de foto inderdaad bekeken en het groepje daar komt inderdaad anders over, maar het enige wat ik zie wat iets anders is dan mijn rietgans is dat bij die ganzen de ondersnavel na de helft van de snavel niet meer te zien is (lijkt wel afgebroken) wat een heel raar beeld geeft.
 
toch zie ik dit niet terug op die plaat met die koppatronen (types ganzen)
 
en dat het dan misschien geen taiga is kan ik mee leven, maar waarom is het dan WEL een toendra? alleen omdat het geen taiga is of zijn er volgens jou ook nog echt harde kenmerken die hier voor toendra pleitten?
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op januari 23, 2010, 16:57:19 pm
Taigarietgans bestaat nog steeds, zit alleen niet meer in Nederland, maar wel daarbuiten.

Ik las deze en vroeg het om die reden, maar ok in de context van de hele post is dat te kort door de bocht en zijn er kennelijk nog wel enkele harde waarnemingen
Titel: Re: rietgans, again...
Bericht door: hcusters op januari 23, 2010, 17:07:52 pm
http://www2.alterra.wur.nl/webdocs/PDFFiles/Alterrarapporten/Alterrarapport155.pdf
Leuke discussie, hier is nog meer leesvoer.
hans custers
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 23, 2010, 17:10:46 pm
ik heb de foto inderdaad bekeken en het groepje daar komt inderdaad anders over, maar het enige wat ik zie wat iets anders is dan mijn rietgans is dat bij die ganzen de ondersnavel na de helft van de snavel niet meer te zien is (lijkt wel afgebroken) wat een heel raar beeld geeft.
 
toch zie ik dit niet terug op die plaat met die koppatronen (types ganzen)
 
en dat het dan misschien geen taiga is kan ik mee leven, maar waarom is het dan WEL een toendra? alleen omdat het geen taiga is of zijn er volgens jou ook nog echt harde kenmerken die hier voor toendra pleitten?

De ondersnavel nij Taiga is platter en dunner dan bij Toendra wat er inderdaad wat vreemd kan uitzien. Dat de tekeningen dat niet zo mooi weergeven moet je misschien de tekenaar 'verwijten': mogelijk heeft hij bewust de verschillen met Toendra niet willen overdrijven of heeft hij minder opvallende vogels als voorbeeld genomen/gehad.
Daarom ziet jouw vogel er meteen anders uit: de (onder-)snavel is veel dikker en vertoont een duidelijke grijns. Maar ook de hals lijkt kort en dik (niet zo betrouwbaar weliswaar) čn de vogel lijkt in zijn oranjesnavelige hoedanigheid alleen (of met een familie donkersnavelige Toendra's natuurlijk....) Niet alleen Trinus wijst erop dat zulke solitaire vogels gewantrouwd moeten worden: ook de Belgische ganzenkenner Dirk Symens roept al jarenlang dat die "groepsentiteit" zoals hij het noemt, erg belangrijk kan zijn bij de determinatie (en dat-ie niks gelooft van "al die" Nederlandse Taiga's....)
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 23, 2010, 17:21:36 pm
ik heb de foto inderdaad bekeken en het groepje daar komt inderdaad anders over, maar het enige wat ik zie wat iets anders is dan mijn rietgans is dat bij die ganzen de ondersnavel na de helft van de snavel niet meer te zien is (lijkt wel afgebroken) wat een heel raar beeld geeft.
 
toch zie ik dit niet terug op die plaat met die koppatronen (types ganzen)
 
en dat het dan misschien geen taiga is kan ik mee leven, maar waarom is het dan WEL een toendra? alleen omdat het geen taiga is of zijn er volgens jou ook nog echt harde kenmerken die hier voor toendra pleitten?

De ondersnavel nij Taiga is platter en dunner dan bij Toendra wat er inderdaad wat vreemd kan uitzien. Dat de tekeningen dat niet zo mooi weergeven moet je misschien de tekenaar 'verwijten': mogelijk heeft hij bewust de verschillen met Toendra niet willen overdrijven of heeft hij minder opvallende vogels als voorbeeld genomen/gehad.
Daarom ziet jouw vogel er meteen anders uit: de (onder-)snavel is veel dikker en vertoont een duidelijke grijns. Maar ook de hals lijkt kort en dik (niet zo betrouwbaar weliswaar) čn de vogel lijkt in zijn oranjesnavelige hoedanigheid alleen (of met een familie donkersnavelige Toendra's natuurlijk....) Niet alleen Trinus wijst erop dat zulke solitaire vogels gewantrouwd moeten worden: ook de Belgische ganzenkenner Dirk Symens roept al jarenlang dat die "groepsentiteit" zoals hij het noemt, erg belangrijk kan zijn bij de determinatie (en dat-ie niks gelooft van "al die" Nederlandse Taiga's....)

Op de foto staat hij inderdaad als oranjesnavelige alleen, maar er liepen er veel meer van deze rond, waaonder ook nog 1 die ik in eerste instantie heb ingevoerd, maar waar ik geen foto van kon krijgen. deze was nog lichter om de kop, ondersnavel niet te zien en de snavel was ook nog eens langer dan deze vogel. maar als dit volgens jou toch wel overduidelijk toendra is zal ik de foto verwijderen om verwarring te voorkomen
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 23, 2010, 19:35:48 pm
Trinus,
 
Interessant om te zien hoe de publieke opinie dankzij jouw bericht blijkbaar snel kan veranderen. Hoewel ik het in grote lijnen zeker met je eens ben, toch enkele kanttekeningen.
- Een steekproef van slechts 288 in Nederland gevangen rietganzen lijkt me veel te klein om de ferme uitspraak dat Taiga 'geheel' uit Nederland verdwenen is, te rechtvaardigen. Daarvoor zou ik nog wel iets meer willen weten. Hoeveel rietganzen werden er telkens tegelijk geringd, hoe waren de ringlocaties verdeeld over het land, etc. Dat de door Burgers et al gegeven verhoudingen inmiddels anders zijn komen te liggen, lijkt me duidelijk, maar dat er nog 'hooguit een handvol' Taiga's overwinteren lijkt me op basis hiervan onvoldoende aangetoond.
- Dat de Taiga's in een paar jaar tijd van snavelkleur zouden zijn gewijzigd is natuurlijk onzin. Maar Leo v.d. Berghs bewering dat de Scandinavische beesten (die jij blijkbaar als type-exemplaar van Taiga beschouwt) in de jaren negentig vervangen zijn door Taiga's uit meer oostelijke populaties, is hiermee nog niet ontkracht. Uit zijn publicaties van slechts enkele jaren geleden bleek overigens nog allerminst dat hij geen Taiga's meer tegenkwam, integendeel...
- Ik vermag, zoals eerder opgemerkt, volstrekt niet in te zien waarom je de door jou aangehaalde foto's van Brummen en de Kraaijenbergsche Plassen (uitgezonderd de rechtse vogel) nu zulke typische groepjes Taiga's vindt. Dat Taiga zeldzaam is, ben ik zonder meer met je eens, maar dat dít nu juist die zeldzame Taiga's zijn, mag je wat mij betreft wel even toelichten...
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op januari 23, 2010, 20:06:18 pm
Het wordt steeds duidelijker; Taiga is geen weggevertje of twijfelgeval, er zijn alleen maar erg duidelijke!! Dat is nou wel duidelijk.


Dat lijkt me wel erg kort door de bocht -- zo makkelijk komen we niet van deze kwestie af. Deze figuur in Ruokonen et al laat bv. duidelijk overlap zien.


Verder heb ik dit najaar wat groepen in Zweden bekeken en ook daar is veel variatie te zien -- beesten met spectaculair grote snavels maar ook beesten die je er naar mijn gevoel in Nederland niet makkelijk uit zou pakken.
Toendra's en ook Kleine Rieten zijn daar schaars, maar allebei worden dikwijls als enkelingen en niet noodzakelijkerwijs in familiegroepjes gezien.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 23, 2010, 20:39:08 pm
Hoi PieterGeert,
Het is denk ik niet zozeer mijn opinie die er mee te maken heeft, maar meer de gegevens die, al discussierend, boven water komen die wellicht een beter oordeel mogelijk maken. Gemotiveerd om dit verhaal duidelijker te krijgen duiken diverse mensen, waaronder ikzelf, dieper in de materie en dit heeft nu in ieder geval er voor gezorgd dat een aantal extra gegevens bekend zijn, die tot nu toe niet in brede kring bekend waren. Op basis daarvan heb ik geprobeerd zo verantwoord mogelijk alles op een rijtje te zetten.
 
Het verhaal over de gevangen Rietganzen in Nederland gedurende 2006-2009 geeft natuurlijk niet de doorslag, het is slechts ondersteunend bedoeld. De voornaamste redenen zijn wat mij betreft het feit dat niemand meer een groep Taigarietganzen kan vinden, ook niet op de plekken waar ze vroeger wel zaten. Het feit dat men in Duitsland en Zweden schrijft dat overwinterende Taigarietganzen zich hebben teruggetrokken in respectievelijk Zweden en het grensgebied tussen Duitsland en Polen en nu ook nog het gegeven dat men zich in het SOVON rapport over de winter 2006/2007 afvraagt in hoeverre de determinatie van Taigarietganzen juist plaats heeft gevonden. Voor mezelf kom ik tot de conclusie dat de Taigarietgans nauwelijks meer in Nederland overwintert. Je moet mijn woordje "een handvol" misschien niet te letterlijk nemen, het kunnen er natuurlijk wel iets meer zijn, maar m.i. zeker geen duizenden.
 
Overigens zijn de ganzenvangers die voor het ringwerk actief waren grotendeels altijd op dezelfde plaatsen actief geweest, namelijk (even uit mijn hoofd) 4 vangers in Friesland, ongeveer 4 in het gebied ten noorden van Amersfoort en ook ongeveer 4 in Brabant grofweg tussen Oss en Den Bosch. De Rietganzen werden vroeger hoofdzakelijk in Brabant gevangen. Ik ben zelf in de provincie Friesland hiermee actief geweest en daar worden nauwelijks Rietganzen gevangen. 
 
Uit halsbandonderzoek van Zweedse vogels is nooit gebleken dat er van die populatie vogels in Nederland overwinteren. Volgens mijn gegevens is slechts 1 vogel met een Zweedse halsband ooit in Nederland waargenomen (Noord-Brabant). De Taigarietganzen die vroeger in Nederland werden geringd zijn hoofdzakelijk uit Rusland teruggemeld. Een Zweedse connectie is nooit vastgesteld. Dat verhaal dat Zweedse vogels vervangen zijn door Taigarietganzen van oostelijker herkomst kan m.i. niet hard gemaakt worden, er is geen enkele aanwijzing voor. Het is ook niet logisch dat terwijl de overwinteringsgebieden van de Taigarietganzen zich naar het noorden en oosten verleggen er ineens vogels uit het oosten westelijker gaan overwinteren, zelfs zo westelijk dat ze in Nederland terecht komen.
 
Ik beschouw de Scandinavische beesten niet noodzakelijkerwijs als type exemplaar. Ik kijk met name naar de verdeling van snavelpatronen zoals die in het artikel van Burgers uit 1991 zijn gepresenteerd en kom tot de conclusie dat die er grofweg hetzelfde uitzien als de vogels waarvan ik een foto heb laten zien uit Zweden.
 
Bij de drie voorbeelden van familiegroepjes die ik heb gegeven schrijf ik dat het lijkt alsof het families Taigarietganzen zijn. Ik durf mijn hand er niet voor in het vuur te steken. Dat moet in het veld vastgesteld worden. Wat ik wel durf te zeggen is dat een groot deel van de foto's van Taigarietganzen die over 2009/2010 gepubliceerd zijn m.i. gewoon Toendrarietganzen betreffen.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 23, 2010, 21:56:22 pm
De type van fabalis komt uit Engeland, zoals al eerder geschreven, alleen welke taxa betrof het hier? Het is maar een aanname dat de type uit Zweden komt. Het type exemplaar is niet meer voorhanden, en er is geen beschrijving gepubliceerd zie; Latham 1787 (gen. Synopsis Birds, suppl., 1. p. 297) Great Britain.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 24, 2010, 09:57:02 am
Maar de uitersten zijn toch wel degelijk herkenbaar? Als we voor beide soorten/ondersoorten/vormen/whatever o.b.v. eerdere determinatieliteratuur een set kenmerken benoemen, en dan (alleen) vogels die aan al deze kenmerken voldoen taiga danwel toendra noemen (oftewel een voorbeeld aan Theo nemen en dan ook voor 'extreme toendra's'), dan zijn we al weer wat verder dan nu toch?

hoi Vincent,
 
En als je dit zou toepassen op Zilvermeeuw versus Amerikaanse Zilvermeeuw? Worden tegenwoordig ook vaak als twee soorten beschouwd. Kom je dan niet snel in de problemen dat je erg veel 'zilvermeeuw spec.' zult moeten invoeren? En wie checkt iedere adulte Zilvermeeuw zo nauwkeurig op kenmerken dat hij/zij met zekerheid kan uitsluiten dat het geen Amerikaanse Zilvermeeuw is?
 
M.i. is het m.b.t. de rietganzen in Nederland nu dus vrij simpel.
(1): Alles wat je in Nederland ziet benoem je als Toendrarietgans Anser serrirostris of als Rietgans Anser fabalis (afhankelijk van je mening of Taigarietgans en Toendrarietgans tot één vogelsoort behoren, of als twee afzonderlijke vogelsoorten door het leven gaan).
(2): Taigarietganzen in Nederland kunnen alleen als zodanig benoemd worden als er een goede beschrijving / foto etc. bijzit. En eventueel pas na een beoordeling.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 24, 2010, 10:17:28 am

 (.......) Tot slot het verslag van een ganzentelling, winter 2008-2009 (http://www.zoo.ekol.lu.se/waterfowl/ANDINV/ANDRAP/Waterfowl_Report_08-09.pdf (http://www.zoo.ekol.lu.se/waterfowl/ANDINV/ANDRAP/Waterfowl_Report_08-09.pdf)). Ook dit rapport geeft aan dat veel rietganzen in Skane overwinteren. In oktober bevinden de vogels zich vooral in midden-Zweden, met name in de "landskappen" Uppland, Södermanland en Västmanland. In januari zijn de grootste concentraties te vinden in Skane en westelijk Blekinge.
 
(....). Wellicht herhaal ik nu allerlei informatie die door anderen (Trinus, Klaas, etc.) al eerder is aangehaald. Anderszijds lijkt met mij gezien de ontwikkelingen niet onverstandig dat er een stevige analyse komt naar het voorkomen van fabilis in Nederland. Wellicht is het in de toekomst een soort die, gezien de lastige determinatie, in aanmerking kan komen voor behandeling door de CDNA? Mijn taiga gaat in ieder geval op onzeker, misschien zelfs wel op toendra.

hoi Redmar,
 
Heel erg bedankt voor het opdiepen van al deze informatie. Leif Nilsson is al decennia een zeer bekende naam in de ganzenwereld (vermoedelijk kent Trinus hem persoonlijk ook wel). De rapporten etc. zijn allemaal wel wat te 'lezen'. Gewoon vanwege de Engelse samenvatting en de Engelse bijschriften bij de figuren etc. En ook door de duidelijke kaartjes en figuren. Ook mooi om te zien dat tijdens de bekende strenge winters in Nederland de januari aantallen bij Rietgans in Zweden flink wat lager zijn.
 
En het is helemaal geen slecht plan om je waarneming(en) van Taigarietgans in Nederland -voorlopig- maar eens even op 'onzeker' te zetten cq. van je lijst af te halen.
 
Het artikel 'Nilsson, L. 2008. Changes in numbers and distribution of wintering waterfowl in Sweden during forty years, 1967-2006. Ornis Svecica 18:135-226.' ziet er ook interessant uit. Staat m.i. niet online. In ieder geval niet op de site van Ornis Svecica, http://www.sofnet.org/index.asp?lev=5599&typ=1 (http://www.sofnet.org/index.asp?lev=5599&typ=1)
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 24, 2010, 10:52:24 am
(....). Misschien komen we nu zo langzamerhand in de fase waarin we met z'n allen wel beter gaan begrijpen "hoe het zit". Uit het SOVON-verslag van de ganzentellingen over 2006/2007 blijkt inderdaad dat daar inmiddels ook wordt getwijfeld aan de juistheid van de determinaties (had ik tot nu toe overheen gelezen). Het lijkt er op dat slechts enkele ganzentellers steevast Taigarietganzen door blijven geven uit hun gebied. Belangrijk om dat eens goed uit te zoeken en met een definitief oordeel hierover te komen. Het stukje over de Taigarietgans in het SOVON-rapport is volgens mij geschreven door Leo van den Bergh. Hij is de soortspecialist van de "Rietganzen" binnen de Ganzen- en Zwanenwerkgroep Nederland. Als hij al twijfelt over de determinatie betekent dit ook dat hij ze zelf niet meer tegenkomt op zijn tochten door Nederland. Dat zegt ook wel iets. Alles op een rijtje gezet kunnen we bijna alleen maar tot de conclusie komen dat de Taigarietganzen in ieder geval in normale winters niet meer in Nederland zitten of hooguit een handvol.

hoi Trinus,
 
Al nadenkende hierover schoot het me te binnen dat ik ook wel eens iets had gelezen in 'Drentse Vogels' over het meer recente voorkomen van Taigarietganzen in Drenthe en omgeving. DV heb ik in de kast staan, en dus maar eens even nagekeken. Er blijken twee recente artikelen over (Taigariet)ganzen verschenen te zijn.
 
(1): Leo van den Bergh 2004. Overwinterende Taigarietganzen en Toendrarietganzen in Drenthe in 1990-2004. Drentse Vogels 18: 1-16. Een zeer gedegen artikel vol met redelijk recente getallen uit Drenthe en aanliggende grensgebieden. Staat helaas niet online http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3 (http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3) Desnoods kan ik wel een scan maken. Ook met veel recente gegevens van Leo zelf. Enkele highlights:
17 januari 2003 ca 1200 Taigarietganzen op slaapplaats Bargerveen (in totaal ruim 22.000 rietganzen; telling Leo).
20 februari 2004 ca 300 Taigarietganzen alhier (telling Leo).
3 januari (of februari?) 2004 ca 1500 Taigarietganzen op graslanden bij Boerenstreek (gemeente Leek); door Leo zelf gezien. Op die dag werden rondom het Fochteloërveen in totaal ca 3600 Taigarietganzen geteld (tijdens vorstperiode).
6 februari 2002 1700 Taigarietganzen (fabalis) en 226 Taigarietganzen (johanseni) op aardappelakkers rond Scheerwolde, ZW van slaapplaats Dwingelderveld (geteld door Leo zelf).
14 februari 2003 740 Taigarietganzen in het dal van de Beilerstroom (Leo zelf).
 
etc. Maar kennelijk dus binnen tien jaar allemaal verdwenen.
 
 
(2): Arend Jan van Dijk & Joop Kleine 2008. In vijftig jaar tijd steeds meer overwinterende ganzen in ZW-Drenthe. Drentse Vogels 22: 28-41. 'Na 1986/87 loopt het gemiddeld aantal Taigarietganzen terug tot 279, met alleen nog hoge aantallen in 1997/98 (1176), 1998/99 (668), 2003/04 (818) en 2005/06 (1051).' [gaat over ganzen die van de slaapplaatsen op en rond het Dwingelderveld gebruik maken].
 
Ook hier dus nu ca. 0 meer van over?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 24, 2010, 10:57:08 am
@Klaas, 09.57u: Als ik goed ben bijgepraat, moet een smith (iig 1e kj) al aan de volle 100% van een goed gedefinieerde kenmerkenset voldoen, voordat ie acceptabel geacht wordt. En van argenteus weten we dat ze erg variabel zijn. Op je vraag wie elke zilver goed checkt is het het antwoord natuurlijk 'te weinig mensen'. Maar als er genoeg vogelaars met een camera rondlopen die een idee hebben van 'verdachte kenmerken', komen we er met behulp van literatuur/de meeuwenkenners wel uit. Over id van smith/argenteus is in elk geval het een en ander geschreven (oa DB-artikel) en hoewel je kunt twisten over de status van beide taxa, is er volgens mij wel min of meer overeenstemming over waar het ene taxon ophoudt en het andere begint: Ook van smith (en m.i. i.t.t. fabalis) zijn verspreidingsgebied en variatie redelijk in kaart gebracht. Daarnaast is er bij smith geen historisch precedent van regelmatig voorkomen in NL.

Bij rieten staat er m.i. veel meer op losse schroeven dan bij zilvers. Waar je in stap 1 van jouw tweestappenplan wat mij (en ik denk ook JvdL) betreft voor moet waken, is dat je duidelijke toendra's als rietgans spec. gaat invoeren. Want of toendra nu een soort, ondersoort of vorm/clinaal uiterste is, met zulke beesten kunnen we in elk geval al wat - i.t.t. de twijfelbeesten. Met 2 ben ik het i.i.g. roerend eens.

Ik heb in navolging van Redmar mijn taiga ook maar op onzeker gezet. Overigens noemde FN hier ergens de dunne ondersnavel en ontbreken van een smile als goede kenmerken voor taiga. Als we het erover eens zijn/worden dat goeie taiga's dat moeten hebben, kunnen er afgaande op de recente foto's van aldanniet onzekere taiga's al heel wat waarnemingen naar rietgans spec. of zelfs toendra ...

Tot slot: Wat vinden de kenners hier van de vogels van AvdB op de DB-site (http://www.dutchbirding.nl/news.php?id=9)? Zijn geelbek doet mij me afvragen hoe waardevol het 'lange nek'-kenmerk is voor fabalis ...
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 24, 2010, 18:28:29 pm
(....). Waar je in stap 1 van jouw tweestappenplan wat mij (en ik denk ook JvdL) betreft voor moet waken, is dat je duidelijke toendra's als rietgans spec. gaat invoeren. Want of toendra nu een soort, ondersoort of vorm/clinaal uiterste is, met zulke beesten kunnen we in elk geval al wat - i.t.t. de twijfelbeesten. Met 2 ben ik het i.i.g. roerend eens.
hoi Vincent,
 
Het voorbeeld Zilvermeeuw / Amerikaanse Zilvermeeuw was misschien wat ongelukkig gekozen (maar hoe zit het met adulte Amerikaanse Zilvermeeuwen? hoe gemakkelijk / eenduidig zijn die te herkennen)? En daarnaast redeneer ik ook een beetje vanuit een ander gezichtspunt. Mijn gezichtspunt is meer die van (grote) groepen die je ziet / telt en waarvan je niet ieder individu één voor één zorgvuldig kunt bekijken.
 
Even een zeer recent voorbeeld. Op 16 januari jl. hebben we een complete hoogwatertelling op Schiermonnikoog uitgevoerd. In totaal 15.180 Zilvermeeuwen, 7789 Stormmeeuwen, 1510 Grote Mantelmeeuwen, 1218 Kokmeeuwen, 3 Kleine Mantelmeeuwen en 2 Geelpootmeeuwen.
 
Ik en de meeste anderen hebben lang niet iedere Zilvermeeuw zo goed bekeken dat we kunnen uitsluiten dat er een Pontische Meeuw (laat staan een Amerikaanse Zilvermeeuw of wat dan ook) tussen zat. Toch noteren we deze groepen (soms moet je een groep van wel 1000 of meer van grote afstand en/of snel tellen) allemaal als Zilvermeeuw en niet als 'grote meeuw spec.', grote witkopmeeuw' o.i.d. En zoiets kun je je dus ook voorstellen bij Toendrarietgans, zeker bij de wat grotere groepen.
 
En tijdens die bewuste telling wilde Frank het Noordzeestrand tellen om de meeuwen op ringen te checken. En op die manier kwam hij dus de 3 Kleine Mantels en de 2 Geelpootmeeuwen tegen. Ze zitten er dus wel tussen, maar zijn dus voor ons geen aanleiding om al te snel geen soortsnaam te plakken op grote groepen.
 
En natuurlijk: het is altijd beter om ieder individu goed & zorgvuldig te bekijken. Maar dat is gewoon in de praktijk bij allerlei grootschalige vogeltellingen onmogelijk. Denk maar eens aan meeuwenslaaptrektellingen.
 
En hoe meer ik er nu over lees & over nadenk, hoe eenvoudiger het allemaal wordt. Alle 'rietganzen' in Nederland kun je gewoon beschouwen / noteren als Toendrarietgans, tenzij je duidelijk bewijs hebt van het tegendeel. Net zoals je alle 'zilvermeeuwachtige meeuwen' ook gewoon noteert als Zilvermeeuw, tenzij je duidelijk bewijs / aanwijzingen hebt van wat anders.
 
En laat maar komen, al die claims van 100 of 1000 of meer Taigarietganzen in Nederland.
 
En het is broodnodig dat er snel een gedegen publicatie in Limosa en/of Dutch Birding komt met daarin:
(1): de huidige status van de Taigarietgans in Nederland,
(2) een terugblik naar (heel) vroeger,
(3) een deugdelijke analyse (revisie?) van alle gepubliceerde aantallen van de afgelopen pakweg 15 jaar.
 
En zie ook http://www.birdwatch.co.uk/website/content/view/2006/29/ (http://www.birdwatch.co.uk/website/content/view/2006/29/) voor wat achtergronden over herkenning.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 24, 2010, 18:58:35 pm
Volgens mij zijn we het grotendeels eens. Met dat verschil dat het er natuurlijk bij het positief identificeren van een taigarietgans wat anders aan toegaat dan bij het tellen van grote groepen. Ik vraag me trouwens af of het zinvol is om bij groepen toendra's alerter te zijn op de aanwezigheid van taiga dan bij groepen andere soorten.

Bij ad. (winter) zilver hoef je natuurlijk pas op te gaan letten als 'ie eruit ziet of 'ie net z'n hele kop in een bord muesli gestoken heeft - en al helemaal bij zwart op de tt. Overigens net de nieuwe Collins binnen (voor nog geen E.25 thuis, geen geld!), waarin nu eindelijk volwassen aandacht voor de grote meeuwen incl. am. zilver. Met dank aan flink wat, ook hier actieve NL larofielen  :duim:

En het is inderdaad de hoogste tijd voor een gedegen studie naar rieten.
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 24, 2010, 20:43:58 pm
(....). Misschien komen we nu zo langzamerhand in de fase waarin we met z'n allen wel beter gaan begrijpen "hoe het zit". Uit het SOVON-verslag van de ganzentellingen over 2006/2007 blijkt inderdaad dat daar inmiddels ook wordt getwijfeld aan de juistheid van de determinaties (had ik tot nu toe overheen gelezen). Het lijkt er op dat slechts enkele ganzentellers steevast Taigarietganzen door blijven geven uit hun gebied. Belangrijk om dat eens goed uit te zoeken en met een definitief oordeel hierover te komen. Het stukje over de Taigarietgans in het SOVON-rapport is volgens mij geschreven door Leo van den Bergh. Hij is de soortspecialist van de "Rietganzen" binnen de Ganzen- en Zwanenwerkgroep Nederland. Als hij al twijfelt over de determinatie betekent dit ook dat hij ze zelf niet meer tegenkomt op zijn tochten door Nederland. Dat zegt ook wel iets. Alles op een rijtje gezet kunnen we bijna alleen maar tot de conclusie komen dat de Taigarietganzen in ieder geval in normale winters niet meer in Nederland zitten of hooguit een handvol.

hoi Trinus,
 
Al nadenkende hierover schoot het me te binnen dat ik ook wel eens iets had gelezen in 'Drentse Vogels' over het meer recente voorkomen van Taigarietganzen in Drenthe en omgeving. DV heb ik in de kast staan, en dus maar eens even nagekeken. Er blijken twee recente artikelen over (Taigariet)ganzen verschenen te zijn.
 
(1): Leo van den Bergh 2004. Overwinterende Taigarietganzen en Toendrarietganzen in Drenthe in 1990-2004. Drentse Vogels 18: 1-16. Een zeer gedegen artikel vol met redelijk recente getallen uit Drenthe en aanliggende grensgebieden. Staat helaas niet online http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3 (http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3) Desnoods kan ik wel een scan maken. Ook met veel recente gegevens van Leo zelf. Enkele highlights:
17 januari 2003 ca 1200 Taigarietganzen op slaapplaats Bargerveen (in totaal ruim 22.000 rietganzen; telling Leo).
20 februari 2004 ca 300 Taigarietganzen alhier (telling Leo).
3 januari (of februari?) 2004 ca 1500 Taigarietganzen op graslanden bij Boerenstreek (gemeente Leek); door Leo zelf gezien. Op die dag werden rondom het Fochteloërveen in totaal ca 3600 Taigarietganzen geteld (tijdens vorstperiode).
6 februari 2002 1700 Taigarietganzen (fabalis) en 226 Taigarietganzen (johanseni) op aardappelakkers rond Scheerwolde, ZW van slaapplaats Dwingelderveld (geteld door Leo zelf).
14 februari 2003 740 Taigarietganzen in het dal van de Beilerstroom (Leo zelf).
 
etc. Maar kennelijk dus binnen tien jaar allemaal verdwenen.
 
 
(2): Arend Jan van Dijk & Joop Kleine 2008. In vijftig jaar tijd steeds meer overwinterende ganzen in ZW-Drenthe. Drentse Vogels 22: 28-41. 'Na 1986/87 loopt het gemiddeld aantal Taigarietganzen terug tot 279, met alleen nog hoge aantallen in 1997/98 (1176), 1998/99 (668), 2003/04 (818) en 2005/06 (1051).' [gaat over ganzen die van de slaapplaatsen op en rond het Dwingelderveld gebruik maken].
 
Ook hier dus nu ca. 0 meer van over?
 
Groetjes, Klaas

Alle respect voor Leo, absoluut.
Zoveel zelfs dat ik geloof dat hij Taiga van Toendra onderscheid op een slaapplaats...
Zal mij in het dimmende licht absoluut niet lukken.

Theo
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 24, 2010, 21:35:16 pm
Al nadenkende hierover schoot het me te binnen dat ik ook wel eens iets had gelezen in 'Drentse Vogels' over het meer recente voorkomen van Taigarietganzen in Drenthe en omgeving. DV heb ik in de kast staan, en dus maar eens even nagekeken. Er blijken twee recente artikelen over (Taigariet)ganzen verschenen te zijn.
 
(1): Leo van den Bergh 2004. Overwinterende Taigarietganzen en Toendrarietganzen in Drenthe in 1990-2004. Drentse Vogels 18: 1-16. Een zeer gedegen artikel vol met redelijk recente getallen uit Drenthe en aanliggende grensgebieden. Staat helaas niet online http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3 (http://www.avifaunadrenthe.nl/index.php?page_id=13&cp=3) Desnoods kan ik wel een scan maken.
Hoi Klaas,
 
Bedankt voor alle gegevens die je hebt uitgezocht. Dat artikeltje van Leo uit 2004 heb ik niet zelf. Ik kan het ook niet online vinden. Als je me daarvan een keer een scan kunt sturen zou dat heel mooi zijn. Je hebt mijn emailadres nog wel ergens als het goed is.
 
Nu het moment aangebroken lijkt dat iedereen alles lijkt te begrijpen en we het toch over Leo van den Bergh hebben hier nog even een link naar een artikel (in 2 delen) EDIT (in 3 delen) van hem over de situatie rond Nijmegen. Hier komen ze:
Deel 1: http://www.vogelwerkgroepnijmegen.nl/I-2003-3.pdf (http://www.vogelwerkgroepnijmegen.nl/I-2003-3.pdf)  bladzijde 90 t/m 97
Deel 2: http://www.vogelwerkgroepnijmegen.nl/I-2004-1.pdf (http://www.vogelwerkgroepnijmegen.nl/I-2004-1.pdf)  bladzijde 18 t/m 26
Deel 3: http://www.vogelwerkgroepnijmegen.nl/I-2004-3.pdf (http://www.vogelwerkgroepnijmegen.nl/I-2004-3.pdf)  bladzijde 11 t/m 25
Als je die verhalen leest begint het bijna te duizelen van de soorten en ondersoorten die hij daar tegen is gekomen. Begrijpen we het dan misschien toch niet?
Titel: Re: rietgans, again...
Bericht door: marijn op januari 24, 2010, 23:21:30 pm
Mooie Taiga's door Justin Jansen en Max Berlijn vandaag: http://waarneming.nl/waarneming/view/46146100 (http://waarneming.nl/waarneming/view/46146100)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 25, 2010, 07:39:07 am
Op http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&land=all (http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&land=all) staan ook nog een rij foto's van Taigarietganzen.
 
Trinus, ik zal binnenkort een scan maken en het aan je opsturen. Wellicht plaats ik de pdf als bijlage ook wel in dit forum. Want dan kan iedereen het artikel eens even lezen. 't Is min of meer vergelijkbaar als de stukken in de Mourik.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 25, 2010, 09:50:15 am
Mooie Taiga's door Justin Jansen en Max Berlijn vandaag: http://waarneming.nl/waarneming/view/46146100 (http://waarneming.nl/waarneming/view/46146100)

Inderdaad. lijkt me weinig twijfel over toch?
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 25, 2010, 09:53:48 am
Citaat
@Vincent: Ik denk dat je Taiga's wel degelijk tussen groepen Toendra's moet zoeken. Althans, op één uitzondering na (http://waarneming.nl/waarneming/view/41211062 (http://waarneming.nl/waarneming/view/41211062)) zaten al mijn zekere Taiga's tussen (of, vaker nog, aan de rand van) een groep Toendra's. Net als Kleine Rieten, die vind je in het binnenland door de bank genomen ook tussen de Toendra's en maar zelden tussen de Kollen.


Dit lijkt mij inderdaad ook een erg mooie taiga. vooral de hals valt nu heel erg op en maakt van mijn eerder geuploade rietgans spec zeker geen zekere taiga meer.
ik heb het idee dat ik het allemaal wat beter begin te snappen met de goeie foto's die in dit topic staan en dat het dus eigenlijk toch niet zo heel lastig is maar dat het probleem ligt bij mensen die proberen van elke toendra die ook maar iets richting taiga gaat een taiga te maken, waardoor er veel foto's komen van vogels die eigenlijk geen taiga zijn, maar wel als zodanig gedetermineerd worden waardoor anderen zulke vogels als voorbeeld gebruiken en zelf dus ook rietganzen fout determineren als taiga's?
 
of sla ik nu compleet de plank mis?
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op januari 25, 2010, 10:24:13 am
of sla ik nu compleet de plank mis?
Ik zou het zo in elk geval niet hebben durven formuleren. Misschien doe je nu toch een aantal mensen tekort.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 25, 2010, 10:27:27 am
Op http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&land=all (http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&land=all) staan ook nog een rij foto's van Taigarietganzen.
 
Trinus, ik zal binnenkort een scan maken en het aan je opsturen. Wellicht plaats ik de pdf als bijlage ook wel in dit forum. Want dan kan iedereen het artikel eens even lezen. 't Is min of meer vergelijkbaar als de stukken in de Mourik.
 
Groetjes, Klaas

En wat vind je van deze beesten dan? vind je het zelf ook echte taiga's?
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 25, 2010, 10:45:38 am
........... en dat het dus eigenlijk toch niet zo heel lastig is ...................
of sla ik nu compleet de plank mis?

Folkert Jan, hoe zou het komen denk je dat dit al het zoveelste topic is over dit probleem met alweer de tigste bijdrage? Dat zich hierover tal van goeie vogelaars hebben gebogen en het hoofd gebroken? Omdat het allemaal "eigenlijk niet zo heel lastig is"?
Ja, je slaat de plank compleet mis.......
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 25, 2010, 11:42:19 am
W.b. Leo v.d. Bergh: zijn determinaties zijn altijd zeer gedetailleerd, maar verre van onomstreden.
Ik ben blij dat jij zegt wat ik denk, hoef ik het niet meer te zeggen.
 
@ Trinus: Ik zit op m'n werk en heb dus m'n literatuur niet bij de hand (dat krijg je als je thuis geen Internet hebt), maar als ik me niet sterk vergis bestond de artikelenserie in de Mourik waar jij aan refereert toch uit drie i.p.v. uit twee delen?
Je hebt gelijk, ik had deel 3 over het hoofd gezien, die heb ik ook nog even aan mijn vorige post toegevoegd.
 
@Klaas. Bedankt dat je het artikeltje in dit topic wilt plaatsen!
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 25, 2010, 15:53:42 pm
Wegens grote werkdruk maar eens een weekje geen forum bezocht, en zo te lezen was dat niet onverstandig.
 
Het is al eerder aan bod geweest, maar je kunt zeggen over Leo's determinaties wat je wil, maar hij heeft ontzettend veel praktijkervaring en volgens mij ook een goed oog voor de variatie. Wel kun je je afvragen of het nu zo verstandig is om dan gelijk met ondersoortnamen te gaan smijten. Neem nu het soort vogels dat ik afgelopen weekend fotografeerde:
 
http://waarneming.nl/waarneming/view/46160978 (http://waarneming.nl/waarneming/view/46160978)
 
In de meeste ID-artikelen (zo ook dat van Thomas Heinicke) wordt met geen woord over dit soort dieren gerept, maar ik kan me zo voorstellen dat dit het soort vogels zijn dat Leo serrirostris noemt. Ze zijn overigens ook niet echt zeldzaam, want een groep van ca. 300 van dit soort vogels zat eerder in de buurt van Oss. Die heb ik indertijd gewoon als Taiga’s ingevoerd omdat ik me er over verbaasde dat anderen zo’n groep (waarvan vrijwel geen enkele vogel met een snavel-met-bandje) doodleuk als Toendra’s invoerden, maar ik geef toe dat dat niet zo netjes van me was. Weet aan de andere kant ook niet zeker of dit soort vogels nu echt in de Toendra-hoek thuishoort, er lopen ook vogels met een wat nettere snavel rond (en ook wat geel-snavelige vogels met een kolletje). Zal mijn waarnemingen eens opschonen en een deel als rietgans spec. invoeren.
 
Mijn bijdrage aan de literatuurhoek:
 
http://www.birdlife.no/prosjekter/rapporter/2009_02_NOF.pdf (http://www.birdlife.no/prosjekter/rapporter/2009_02_NOF.pdf)
 
Ook in Noorwegen broeden al bijna geen Taiga-rietganzen meer!
 
Misschien voelt een van jullie zich nu zelfverzekerd genoeg om wat commentaar te geven bij deze vogels:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31477 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31477)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31478 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31478)
 
Denk dat we nu net met z'n allen hebben besloten dat dit wel Toendra’s zullen zijn toch?
 >:D
 
Lützen
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 25, 2010, 21:07:40 pm
Beste mensen,
 
Zonet een pdf gemaakt van het artikel over Taigarietganzen en Toendrarietganzen in Drenthe (Drentse Vogels, jaargang 18, 2004). Via via even verkleind. Veel leesplezier en laat maar op dit forum weten wat je ervan vindt.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 25, 2010, 21:46:49 pm
Mooie Taiga's door Justin Jansen en Max Berlijn vandaag: http://waarneming.nl/waarneming/view/46146100 (http://waarneming.nl/waarneming/view/46146100)

Inderdaad. lijkt me weinig twijfel over toch?
Wat mij betreft wel; nek is niet echt lang en smal, snavelbasis is hoog, snavelboven en onderzijde mi niet recht genoeg, grijns te duidelijk, geen waggelgans, donkere kop. Wellicht toch nog net taiga's maar zeker geen mooie.

Theo
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 26, 2010, 13:05:44 pm
Wat betreft die grijns is er toch ook wel enige discrepantie tussen wat wij denken te zien en wat er gemeten wordt. Als je de data bekijkt van Ruokonen et al. en je vergelijkt de metingen voor de ROS en FAB mtDNA vogels dan is de kleinste grijnsplek van de 6 ROS vogels 6.03 mm (en de daaropvolgende 6.13 mm).  Van de 17 FAB vogels met metingen hebben er maar liefst 8 (bijna de helft dus) een groter grijnsplek (dwz >6.13 mm). Waarmee ik maar aan wil geven dat statistische significantie op steekproef-niveau niet noodzakelijkerwijs iets zegt over bruikbaarheid in het veld. Natuurlijk is het wel zo dat de indruk in het veld mede afhangt van de dikte/lengte/vorm van de snavel.
 
Daarom nog maar eens een foto van een Taigarietgans met een flinke grijns (en een ronde kop en een vrij hoge snavelbasis):
 
http://www.hannuhuttu.com/gallery/albums/testi/normal_2005_08_20_061.jpg (http://www.hannuhuttu.com/gallery/albums/testi/normal_2005_08_20_061.jpg)
 
Lützen
 
 
Voor wie het Pools meester is heb ik deze nuttige site nog in de aanbieding:
http://www.digiscoping.pl/archives/191 (http://www.digiscoping.pl/archives/191)
 
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 26, 2010, 22:17:10 pm
(....). De voornaamste redenen zijn wat mij betreft het feit dat niemand meer een groep Taigarietganzen kan vinden, ook niet op de plekken waar ze vroeger wel zaten. Het feit dat men in Duitsland en Zweden schrijft dat overwinterende Taigarietganzen zich hebben teruggetrokken in respectievelijk Zweden en het grensgebied tussen Duitsland en Polen en nu ook nog het gegeven dat men zich in het SOVON rapport over de winter 2006/2007 afvraagt in hoeverre de determinatie van Taigarietganzen juist plaats heeft gevonden. Voor mezelf kom ik tot de conclusie dat de Taigarietgans nauwelijks meer in Nederland overwintert. Je moet mijn woordje "een handvol" misschien niet te letterlijk nemen, het kunnen er natuurlijk wel iets meer zijn, maar m.i. zeker geen duizenden. (.....)
hoi Trinus,
 
Op waarneming.nl (http://waarneming.nl/soort/view/338 (http://waarneming.nl/soort/view/338)) staan een flinke waslijst aan (zeer) recente waarnemingen, en waarnemingen van flink grote groepen Taigarietganzen. Bijvoorbeeld 300 bij Anderen (25 jan), 50 ergens in Nederland (24 jan), 60 bij Hardenberg (23 jan), 70 gemeente Noordenveld (21 jan).
 
En zonet kreeg ik een bericht via fabalis@yahoogroups.com onder ogen waarin Berend Voslamber stelt: "as far as I know no clear Taiga's have been seen in the Netherlands so far. As normally there are some claims, but the pictures I have seen so far are only taiga-looking tundra's."
 
Er lijkt dus iets niet te kloppen. Of spreken we over twee typen / soorten Taigarietganzen?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 26, 2010, 22:26:22 pm
(....). De voornaamste redenen zijn wat mij betreft het feit dat niemand meer een groep Taigarietganzen kan vinden, ook niet op de plekken waar ze vroeger wel zaten. Het feit dat men in Duitsland en Zweden schrijft dat overwinterende Taigarietganzen zich hebben teruggetrokken in respectievelijk Zweden en het grensgebied tussen Duitsland en Polen en nu ook nog het gegeven dat men zich in het SOVON rapport over de winter 2006/2007 afvraagt in hoeverre de determinatie van Taigarietganzen juist plaats heeft gevonden. Voor mezelf kom ik tot de conclusie dat de Taigarietgans nauwelijks meer in Nederland overwintert. Je moet mijn woordje "een handvol" misschien niet te letterlijk nemen, het kunnen er natuurlijk wel iets meer zijn, maar m.i. zeker geen duizenden. (.....)
hoi Trinus,
 
Op waarneming.nl (http://waarneming.nl/soort/view/338 (http://waarneming.nl/soort/view/338)) staan een flinke waslijst aan (zeer) recente waarnemingen, en waarnemingen van flink grote groepen Taigarietganzen. Bijvoorbeeld 300 bij Anderen (25 jan), 50 ergens in Nederland (24 jan), 60 bij Hardenberg (23 jan), 70 gemeente Noordenveld (21 jan).
 
En zonet kreeg ik een bericht via fabalis@yahoogroups.com onder ogen waarin Berend Voslamber stelt: "as far as I know no clear Taiga's have been seen in the Netherlands so far. As normally there are some claims, but the pictures I have seen so far are only taiga-looking tundra's."
 
Er lijkt dus iets niet te kloppen. Of spreken we over twee typen / soorten Taigarietganzen?
 
Groetjes, Klaas

Hoi Klaas, Doelt Voslamber erop, dat hij ze nog niet gezien heeft in de Ooijpolder? Hij kijkt toch alleen maar halsbanden?
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 26, 2010, 22:50:28 pm
Wat betreft die grijns is er toch ook wel enige discrepantie tussen wat wij denken te zien en wat er gemeten wordt. Als je de data bekijkt van Ruokonen et al. en je vergelijkt de metingen voor de ROS en FAB mtDNA vogels dan is de kleinste grijnsplek van de 6 ROS vogels 6.03 mm (en de daaropvolgende 6.13 mm).  Van de 17 FAB vogels met metingen hebben er maar liefst 8 (bijna de helft dus) een groter grijnsplek (dwz >6.13 mm). Waarmee ik maar aan wil geven dat statistische significantie op steekproef-niveau niet noodzakelijkerwijs iets zegt over bruikbaarheid in het veld. Natuurlijk is het wel zo dat de indruk in het veld mede afhangt van de dikte/lengte/vorm van de snavel.
 
Daarom nog maar eens een foto van een Taigarietgans met een flinke grijns (en een ronde kop en een vrij hoge snavelbasis):
 
http://www.hannuhuttu.com/gallery/albums/testi/normal_2005_08_20_061.jpg (http://www.hannuhuttu.com/gallery/albums/testi/normal_2005_08_20_061.jpg)
 
Lützen
 
 

 
Wat maakt dit dan een zekere taiga? geringd in broedgebied?
 
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 26, 2010, 23:02:58 pm
Hoe komt het nu trouwens dat in sommige literatuur gesteld wordt dat toendra's met veel oranje op de snavel erg zeldzaam zijn, maar ik ze toch vrij vaak tegenkom
 
dat het niet zon goed kenmerk is blijkt wel uit dit topic, maar waarom wordt het dan toch overal genoemd?
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 26, 2010, 23:15:18 pm
Hoe komt het nu trouwens dat in sommige literatuur gesteld wordt dat toendra's met veel oranje op de snavel erg zeldzaam zijn, maar ik ze toch vrij vaak tegenkom
 
dat het niet zon goed kenmerk is blijkt wel uit dit topic, maar waarom wordt het dan toch overal genoemd?

Omdat 'men' soms al te snel conclusies trekt (feiten niet grondig genoeg checkt), die desondanks met enige overtuiging publiceert en sommige andere auteurs zelfs die moeite niet nemen en klakkeloos napraten/overschrijven wat die eersten gezegd/geschreven hebben en sommige lezers alles geloven wat er geschreven staat en weer doorvertellen aan andere goedgelovige sukkels met een verrekijker en........ 8)
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 26, 2010, 23:16:01 pm
(....). De voornaamste redenen zijn wat mij betreft het feit dat niemand meer een groep Taigarietganzen kan vinden, ook niet op de plekken waar ze vroeger wel zaten. Het feit dat men in Duitsland en Zweden schrijft dat overwinterende Taigarietganzen zich hebben teruggetrokken in respectievelijk Zweden en het grensgebied tussen Duitsland en Polen en nu ook nog het gegeven dat men zich in het SOVON rapport over de winter 2006/2007 afvraagt in hoeverre de determinatie van Taigarietganzen juist plaats heeft gevonden. Voor mezelf kom ik tot de conclusie dat de Taigarietgans nauwelijks meer in Nederland overwintert. Je moet mijn woordje "een handvol" misschien niet te letterlijk nemen, het kunnen er natuurlijk wel iets meer zijn, maar m.i. zeker geen duizenden. (.....)
hoi Trinus,
 
Op waarneming.nl (http://waarneming.nl/soort/view/338 (http://waarneming.nl/soort/view/338)) staan een flinke waslijst aan (zeer) recente waarnemingen, en waarnemingen van flink grote groepen Taigarietganzen. Bijvoorbeeld 300 bij Anderen (25 jan), 50 ergens in Nederland (24 jan), 60 bij Hardenberg (23 jan), 70 gemeente Noordenveld (21 jan).
 
En zonet kreeg ik een bericht via fabalis@yahoogroups.com onder ogen waarin Berend Voslamber stelt: "as far as I know no clear Taiga's have been seen in the Netherlands so far. As normally there are some claims, but the pictures I have seen so far are only taiga-looking tundra's."
 
Er lijkt dus iets niet te kloppen. Of spreken we over twee typen / soorten Taigarietganzen?
 
Groetjes, Klaas
Hoi Klaas, eigenlijk sluit Berend zijn opmerking goed aan op wat ik eerder heb geschreven, namelijk dat er in Nederland geen danwel nauwelijks Taigarietganzen overwinteren. De Taigarietganzen die worden gezien zijn overwegend Toendrarietganzen die een beetje weg hebben van Taiga's. Dat er op waarneming.nl diverse waarnemingen van grotere groepen vermeld staan zegt ook niet alles. Het kan natuurlijk wel, maar dan zou het mooi zijn als dat ook onomstotelijk wordt aangetoond. Niemand heeft dit echter nog kunnen aantonen met foto's. Er zijn mij geen foto's bekend uit 2009/2010 uit NL waarop overduidelijke Taigarietganzen staan afgebeeld, behalve dan een aantal beesten "waar een luchtje aan zit". Er zouden een aantal familiegroepjes in ZO-Nederland kunnen zitten, maar het zal niet veel zijn, zeker niet in normale winters.
 
Ik denk dat het goed is om ook nog even op de Poolse site te kijken waarvan Lützen vandaag de link doorgaf, namelijk: http://www.digiscoping.pl/archives/191 (http://www.digiscoping.pl/archives/191) Deze site kende ik nog niet. Als je de foto's aanklikt zie je onder de foto's steeds staan welke (onder)soorten te zien zijn. In de gevallen waar zowel Toendra's als Taiga's staan afgebeeld is in alle gevallen zeer duidelijk wat de Toendra's zijn en wat de Taiga's. Het is goed als referentie te gebruiken voor diegenen die denken Taigarietganzen te hebben gezien. Op de Poolse site zien de Taigarietganzen er ook echt uit als Taigarietganzen.
 
Uit de andere foto van Lützen van de Taigarietgans met een flinke grijns en een m.i. vrij korte snavel blijkt dat er ook Taigarietganzen zijn die er minder karakteristiek uit zien. Als je alle andere foto's bekijkt van diezelfde fotograaf (Hannu Hutu), dan zie je dat alle andere vogels uit de Finse broedgebieden er wel "standaard" uitzien: http://www.hannuhuttu.com/gallery/thumbnails.php?album=search&cat=0&page=1 (http://www.hannuhuttu.com/gallery/thumbnails.php?album=search&cat=0&page=1)
Deze link levert 30 pagina's met foto's van Taigarietganzen op, sommige van geschoten exemplaren, dus jullie zijn gewaarschuwd.
 
Ook nog even een link naar een kleine pdf file waarin o.a. een kaartje met de verspreiding van de "Waldsaatgans" in Duitsland in 1996-2005: http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf (http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf)
Uit dit kaartje blijkt dat de Taigarietgans in Duitsland uitsluitend wordt waargenomen in de noordoostelijke deelstaten.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 27, 2010, 11:13:04 am
Beste Allemaal,
 
Ik lees met belangstelling dit topic de laatste tijd. Ik doe al vanaf begin negentiger jaren mijn best om Taiga's te vinden in NL. In het begin van de negentiger jaren heb ik groepen gezien rond de Vugtse Gement (met Ruud van Dongen speciaal naar toe gegaan) , langs de Ooievaarsweg in Flevoland (met video opname +/-50 vogels enkel Taiga's, en "geelbekken") en na lang zoeken enkel in Limburg (vooral rond Heusden). Ook ben ik meerdere malen in oranjesnavelige Toendra's gestonken (vaak ook in familiegroepjes omdat de meer orange snavel volgens mij binnen families vererft).
 
Ik heb eigenlijk altijd veel moeite gehad om overtuigende Taiga's te vinden en dus ook al voor een hele lange tijd.
 
De vogels van de Kraaijenbergse Plassen van afgelopen weekend waren voor mij de eerste overtuigende sinds lange tijd (zie de foto's en Theo ze hadden juist een veel minder donkere nek dan de aanwezige Toendra's en waren aanzienlijk groter).
 
Als ik op waarn.nl kijk naar de foto's van Taiga's moet ik eigenlijk net als in het veld goed zoeken om vogels tegen te komen die op Taiga's lijken dan wel taiga's zijn.
 
Conclusie voor mijzelf is dus dat de overschatting van de aantallen Taiga's al jaren oud is (begin negentiger jaren was het dus al moeilijk). Het is in de loop der jaren nog moeilijker geworden ze te vinden. Veel plekken die van oudher terecht of onterecht werden opgevoerd als standaard plekken voor Taiga's zijn in ieder geval nu bevolkt door Toendra's
 
MAAR ik geloof wel dat er in de winter nog steeds kleine (familie) groepjes te vinden zijn in NL (Kraaijenbergse Plassen, check ook de decemberfoto's van drie van deze vogels van Justin). Ik denk dat we moeten oppassen een oud probleem geheel uit zijn verband te trekken door te zeggen dat er geen Taiga's meer in NL zitten in de recente winters. Ik kan me dat gezien de populatie en het voorkomen dichtbij NL ook niet voorstellen. We zien toch ook 10+ Dwergganzen in NL elke winter waarvan we vermoeden dat ze niets met de herintroductieprojecten te maken hebben (tussen kolganzen, zie recent de vogel van de Ooijpolder). Ik denk dat we moeten uitkijken dat we dadelijk alleen maar geringde gevallen serieus gaan nemen (zoasl bijv bij fuscus) en daardoor een verkeerd beeld krijgen van het voorkomen, of zoals nu op de DB site gedaan wordt waarbij op eens de kust de beste plek is om de soort te zien in NL omdat daar een van de beste fotograven van NL de beste recente vogels in NL heeft gefotografeerd. Zie bijv. het kaartje van het voorkomen in Duisland in de winters tussen 1996-2005 (NO duitsland). Ervan uitgaande dat de ID in Duitsland tijdens de tellingen wel goed is gegaan zou je dus juist oost Nederland als de meest voor de hand liggende vindplek moeten bestempelen en laat dat van oudsher nou net zijn aangenomen.....
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 27, 2010, 16:19:06 pm
Ik denk dat wat Max schrijft hetzelfde is als wat ik bedoel, namelijk dat er in Nederland heel weinig Taigarietganzen overwinteren. Het is dus zoeken naar een paar spelden in een hooiberg.
 
Dat er vogels aan de kust kunnen opduiken is misschien minder raar dan het lijkt. Dit kunnen afgedwaalde individuen zijn van de groep van circa 300 Taiga's die in de Yare Valley in Norfolk overwintert. Die groep vogels trekt via Noord-Denemarken naar Norfolk. Het is zeer goed mogelijk dat daarvan een beperkt aantal onder bepaalde (weers)omstandigheden in Nederland terecht zou kunnen komen (waddeneilanden, kust).
 
De dichtsbijzijnde reguliere overwinteringsgebieden (in NO-Duitsland) liggen tegenwoordig zo ver van Nederland verwijderd dat de kans op vogels van de in Norfolk overwinterende groep intussen misschien wel groter is. 
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 27, 2010, 17:04:02 pm
Ik zou toch ook wel eens foto's willen zien van die Norfolk vogels, zo ook van die overwinteraars in NO Duitsland.
 
Mogelijk heb ik een linkje er naar gemist maar als de ID zo moeilijk is kan je afvragen in hoeverre die overwinterende populaties goed zijn gedetermineerd, toch
 
Ook zou het goed zijn te zoeken naar foto's van Taiga's van de van oudsher in NL bekende (en inmiddels niet meer gebruikte) plekken om te kijken of die determinatie wel klopte.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 27, 2010, 17:06:04 pm
FF hardop denkend, in deze vorstperiode verblijven grofweg 25.000+ rietganzen (meer dan 30 % van de geschatte wereldpopulatie fabalis en rossicus bij elkaar (700.000 stuks alles bij elkaar)) in de verre omgeving van de peel dus oostzijde Brabant en Noord-Limburg, wat een behoorlijk percentage is van de in Nederland overwinterende Rietganzen. Is het niet aannemelijk om juist in deze groepen Taigarietganzen te vinden, dit ook vanwege het historisch beeld dat deze vogels opduiken in het oosten.

(informatie uit Bijlsma et al 2001. Algemene en Schaarse Vogels)
Titel: Re: rietgans, again...
Bericht door: Bas vd Burg op januari 27, 2010, 17:15:31 pm
Zelf lees ik de diverse fora over dit onderwerp erg regelmatig en ben de afgelopen weken erg fanatiek achter elke waarneming van Taigarietgans in de omgeving van Katwijk/Noordwijk aan gegaan, maar zonder resultaat. En met mij nog een paar anderen uit de regio (oa Ab Steenvoorden, Peter Spierenburg). Wel een paar keer verdachte vogels gezien, maar toen toch maar als Toendrarietganzen genoteerd.
 
Naar aanleiding van alle waarnemingen in de regio Katwijk/Noordwijk is lokaal ook een discussie ontstaan over de determinatie van Taigarietganzen, ook mede naar aanleiding van de diverse fora hier op waarneming.nl.
 
Maar waar ik erg benieuwd naar ben is of de artikelen waar Leo vd Bergh aan refereert in
het artikel over Taigarietganzen en Toendrarietganzen in Drenthe (Drentse Vogels, jaargang 18, 2004), en dan met name zijn eigen artikelen, nog ergens digitaal te vinden zijn op het www. Wellicht heb ik ergens een berichtje of de diverse fora over het hoofd gezien hoor.
 
(PS tot op heden heb ik eigenlijk maar 1 Taigarietgans gezien, althans op basis van mijn huidige kennis en het betreft de vogel van januari 2008 in Polder Boekhorst ten westen van Voorhout, gemeente Teylingen)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 27, 2010, 17:53:52 pm
Hoe komt het nu trouwens dat in sommige literatuur gesteld wordt dat toendra's met veel oranje op de snavel erg zeldzaam zijn, maar ik ze toch vrij vaak tegenkom. dat het niet zon goed kenmerk is blijkt wel uit dit topic, maar waarom wordt het dan toch overal genoemd?
hoi Folkert Jan,
 
Bijgaand in ieder geval even een scan van de pagina met Taigarietgans en Toendrarietgans uit de DB Kenmerkengids uit 2002. En in de link die Trinus gaf, http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf (http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf) staat ook nog een veelbelovend artikel:
HEINICKE, T., J. MOOIJ & J. STEUDTNER (2005): Zur Bestimmung von Saatgans (Anser f. fabalis, A. f. rossicus) und Kurzschnabelgans (Anser brachyrhynchus) und deren Auftreten in Ostdeutschland. Mitt. Ver. Sächs. Ornithol. 9: 533–553.
 
Het lijkt erop dat dit artikel (zie bv http://www.vso-web.de/mitteilungen.html (http://www.vso-web.de/mitteilungen.html)) niet online staat. Maar misschien weet iemand het wel ergens te vinden.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 27, 2010, 17:59:55 pm
Zelf lees ik de diverse fora over dit onderwerp erg regelmatig en ben de afgelopen weken erg fanatiek achter elke waarneming van Taigarietgans in de omgeving van Katwijk/Noordwijk aan gegaan, maar zonder resultaat. En met mij nog een paar anderen uit de regio (oa Ab Steenvoorden, Peter Spierenburg). Wel een paar keer verdachte vogels gezien, maar toen toch maar als Toendrarietganzen genoteerd. (.....). Maar waar ik erg benieuwd naar ben is of de artikelen waar Leo vd Bergh aan refereert in het artikel over Taigarietganzen en Toendrarietganzen in Drenthe (Drentse Vogels, jaargang 18, 2004), en dan met name zijn eigen artikelen, nog ergens digitaal te vinden zijn op het www. Wellicht heb ik ergens een berichtje of de diverse fora over het hoofd gezien hoor.
hoi Bas, leuk dat jullie er ook fanatiek achteraan zitten. Want uiteindelijk moet er toch wel eens helderheid komen. Bedoel je de verschillende artikelen van Leo in 'het Vogeljaar'? Die staan naar mijn weten niet online. Maar wellicht wil de redactie van 'het Vogeljaar' ze wel online zetten. Limosa c.s. schijnt wel bezig te zijn met het digitaliseren van alle oude nummers van Limosa, maar dat project is (nog?) niet afgerond. Bedoeling zou zijn om alles dan op de website van de NOU te zetten (net zoals alles van Ardea).
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 27, 2010, 18:06:17 pm
HEINICKE, T., J. MOOIJ & J. STEUDTNER (2005): Zur Bestimmung von Saatgans (Anser f. fabalis, A. f. rossicus) und Kurzschnabelgans (Anser brachyrhynchus) und deren Auftreten in Ostdeutschland. Mitt. Ver. Sächs. Ornithol. 9: 533–553.
 
Het lijkt erop dat dit artikel (zie bv http://www.vso-web.de/mitteilungen.html (http://www.vso-web.de/mitteilungen.html)) niet online staat. Maar misschien weet iemand het wel ergens te vinden.
Hoi Klaas, dit artikel staat gelukkig wel online, namelijk hier: http://www.dda-web.de/downloads/texts/publications/heinicke_et_al_saat_kurzschnabelgans_in_ostdeutschland.pdf (http://www.dda-web.de/downloads/texts/publications/heinicke_et_al_saat_kurzschnabelgans_in_ostdeutschland.pdf)
en om volledig te zijn is er ook dit artikel nog van Heinicke uit 2004:
http://www.dda-web.de/downloads/texts/publications/heinicke_waldsaatgans_mv.pdf (http://www.dda-web.de/downloads/texts/publications/heinicke_waldsaatgans_mv.pdf)
 
@Max: Kijk voor het Norfolk en Schotland gebeuren naar mijn eerdere post in dit topic: http://forum.waarneming.nl/smf/index.php?topic=99209.msg667125.html#msg667125 (http://forum.waarneming.nl/smf/index.php?topic=99209.msg667125.html#msg667125)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 27, 2010, 18:28:52 pm
  (.....) Ook nog even een link naar een kleine pdf file waarin o.a. een kaartje met de verspreiding van de "Waldsaatgans" in Duitsland in 1996-2005: http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf (http://www.dda-web.de/downloads/posters/poster_gaense2005.pdf) Uit dit kaartje blijkt dat de Taigarietgans in Duitsland uitsluitend wordt waargenomen in de noordoostelijke deelstaten.
hoi Trinus,
 
Ik vond die foto's op de Poolse site erg duidelijk. En ook erg handig om beide (onder)soorten tegelijk op één foto te zien, want dan worden de verschillen / overeenkomsten duidelijker. Het kaartje op bovenstaande link is erg mooi & duidelijk & verhelderend. Dus na tien jaar (fanatiek?) tellen is er geen enkele (=0) Taigarietgans ten westen van Hamburg gezien (midwintertellingen?).
 
Zonet nog weer even op de kaartjes van de jaarlijkse watervogelrapporten van Sovon gekeken. En dan valt het toch erg op dat er een enorm gat zit tussen de waarnemingen in Nederland en die in Duitsland. Voor het gemak even de pagina's met de soortbespreking van Taigarietgans uit de twee meest recente Sovon-rapporten (winter 2004/05 en winter 2005/06) ingescand. Beide met uitgebreide stippenkaarten met de verspreiding van Taigarietgans in Nederland door de maanden heen (rapport van 2006/07 geeft alleen stippenkaarten van soorten als Soepeend [zeer dikke stip in de stad Groningen], Soepgans etc.). En dan komt natuurlijk de vraag op hoe dit alles met elkaar is te rijmen. Zeker als je bedenkt dat veel 'rietganzen' van de slaapplaats Bargerveen ook gebruik maken van het aangrenzende Duitsland. Lopen daar dan geen tellers rond, of ......
 
Beide recente Sovonrapporten stellen dat het totaal aan in Nederland overwinterende Taigarietganzen vermoedelijk wordt onderschat! Dus er zouden best nog wel eens veel (?) meer Taigarietganzen in Nederland kunnen overwinteren. En dat terwijl andere vogelaars ze maar niet kunnen vinden. 't Is wel duidelijk dat ook dit niet met elkaar is te rijmen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 27, 2010, 18:46:06 pm
En er is nog een leuk recent artikel, vooral interessant voor vogelaars die in West-Nederland wonen. D. Tanger & L. van den Bergh 2004. Ondersoorten van Toendra- en Taigarietgans bij Assendelft en Spaarnwoude. Fitis 40 (1): 2-13. Staat m.i. ook niet online (http://www.vwgzkl.nl/publicaties/index.htm (http://www.vwgzkl.nl/publicaties/index.htm)) maar wel met een kleine 'aankondiging.'
 
Het wavo Sovon-rapport 2004/05 refereert eraan met 'Specifiek onderzoek aan Taigarietganzen levert dan ook steevast grotere aantallen op (......) Tanger & van den Bergh 2004).' Wie kon in deze regio maar geen Taigarietganzen vinden? Op naar de regio Assendelft / Spaarnwoude!
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op januari 27, 2010, 19:59:38 pm
Ha Klaas,


Diezelfde Dirk Tanger (die de gebieden die je noemt nog elke winter regelmatig uitkamt op ganzen) noemt op VZK (http://groups.yahoo.com/group/VogelnetZuidKennemerland/msearch?query=taiga&pos=0&cnt=10) slechts 3 zekere waarneming van taigariet (meest kleine groepjes) in de periode 2005-heden. Dus om nou te zeggen dat we hier overspoeld worden ... En die indruk komt dan weer netjes overeen met de bevindingen van AvdB (zelfde regio) zoals verhaald in diens artikel op de DB-site.

De door Klaas bedoelde 'aankondiging':
In een rijk geďllustreerd artikel schetsen Dirk Tanger en Leo van den Bergh een beeld van het voorkomen van Ondersoorten van Toendra- en Taigarietganzen bij Assendelft en Spaarnwoude. Wekelijkse tellingen van ganzen van de herfst 2001 tot april 2003 in de graslanden rond Assendelft en Spaarnwoude brachten een nieuw fenomeen aan het licht, nl. het overwinteren van (taiga)rietganzen van oostelijke herkomst. De herkenning en het voorkomen van de verschillende ondersoorten/vormen van Toendra- en Taigarietganzen wordt uitgebreid besproken. West-Siberische Taigarietgans, Geelbektaigarietgans, Zwartbekfabalis, zware rossicus toendrarietgans etc. etc. passeren alle de revue.
(http://www.vwgzkl.nl/publicaties/fitis_40%281%29.htm#1; vet: VH)
De vraag is inderdaad wat er nou precies staat in dat artikel ;)
Titel: Re: rietgans, again...
Bericht door: Bas vd Burg op januari 27, 2010, 20:12:19 pm
Zelf lees ik de diverse fora over dit onderwerp erg regelmatig en ben de afgelopen weken erg fanatiek achter elke waarneming van Taigarietgans in de omgeving van Katwijk/Noordwijk aan gegaan, maar zonder resultaat. En met mij nog een paar anderen uit de regio (oa Ab Steenvoorden, Peter Spierenburg). Wel een paar keer verdachte vogels gezien, maar toen toch maar als Toendrarietganzen genoteerd. (.....). Maar waar ik erg benieuwd naar ben is of de artikelen waar Leo vd Bergh aan refereert in het artikel over Taigarietganzen en Toendrarietganzen in Drenthe (Drentse Vogels, jaargang 18, 2004), en dan met name zijn eigen artikelen, nog ergens digitaal te vinden zijn op het www. Wellicht heb ik ergens een berichtje of de diverse fora over het hoofd gezien hoor.
hoi Bas, leuk dat jullie er ook fanatiek achteraan zitten. Want uiteindelijk moet er toch wel eens helderheid komen. Bedoel je de verschillende artikelen van Leo in 'het Vogeljaar'? Die staan naar mijn weten niet online. Maar wellicht wil de redactie van 'het Vogeljaar' ze wel online zetten. Limosa c.s. schijnt wel bezig te zijn met het digitaliseren van alle oude nummers van Limosa, maar dat project is (nog?) niet afgerond. Bedoeling zou zijn om alles dan op de website van de NOU te zetten (net zoals alles van Ardea).
 
Groetjes, Klaas

Sterker nog, zodra er een waarneming van Taigarietgans verscheen op waarneming.nl, werd er wat rondgebeld en gingen we met een paar man zoeken (de Taigarietgans is, zeker in de regio duin- en bollenstreek, best wel zeldzaam vandaar dan ook de speciale aandacht). Helaas bleef het vaak bij verdachtlijkende Toendrarietganzen
 
De artikelen waar ik op doel, zijn idd die uit het Vogeljaar en Limosa. Jammer dat ze niet ergens online staan
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 28, 2010, 09:57:55 am
Titel: Re: rietgans, again...
Bericht door: Weia op januari 28, 2010, 10:20:16 am
Citaat van: lupokatja link=topic=99209.msg671076#msg671076 date=1264669075[list
   [li]http://waarneming.nl/waarneming/view/708291 (http://waarneming.nl/waarneming/view/708291)[/l]

'diplodocussen', heel leuk. En ik sluit me aan bij dat het een interessante en leerzame discussie is![/list]
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 28, 2010, 10:52:36 am
Sterker nog, zodra er een waarneming van Taigarietgans verscheen op waarneming.nl, werd er wat rondgebeld en gingen we met een paar man zoeken (de Taigarietgans is, zeker in de regio duin- en bollenstreek, best wel zeldzaam vandaar dan ook de speciale aandacht). Helaas bleef het vaak bij verdachtlijkende Toendrarietganzen. De artikelen waar ik op doel, zijn idd die uit het Vogeljaar en Limosa. Jammer dat ze niet ergens online staan.
hoi Bas,
 
Dat is toch wel heel raar hoor. Staan er meldingen van Taigarietganzen op waarneming.nl (of elders op een site) en dan kunnen jullie ze de volgende dag / dagen maar niet vinden. Terwijl (groepjes) ganzen toch best vaak enige tijd op eenzelfde plek blijven rondhangen. Het staat me bij dat Theo Bakker tegen min of meer hetzelfde probleem opliep toen hij in de Veenkoloniën e.o. op zoek ging naar Taigarietganzen.
 
Wel duidelijk dat er verschillende ideeën zijn over wat nu een Taigarietgans is. En waarom staan er op de site van Dutch Birding geen mooie recente (= seizoen 2009/10) in Nederland gemaakte foto's van onomstreden Taigarietganzen?
 
En zonet even een scan gemaakt van het artikel in Limosa uit 1985 van Leo van den Bergh. Hieronder als eerste een kleurenscan van pagina 16 met twee koppen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: vinexfred op januari 28, 2010, 10:52:57 am


 Nu meen ik begrepen te hebben dat de meer oostelijke populaties een wat minder extreem profiel hebben, maar dan beginnen we al wel te speculeren. Ik stel deze discussie overigens buitengewoon op prijs en zie het als een goede mogelijkheid om er met z'n allen wat van te leren.
  • Lutzen


Als vogelaar met een verleden in Oost-Groningen in de jaren '80 heb ik ze nog steeds op mijn "netvlies" staan, de Taiga's van toen. Ik volg deze zeer interessante discussie echter niet precies genoeg om van alle actuele details op de hoogte te zijn. Recent heb ik wel contact gezocht met Berend Voslamber over onze toenmalige Taiga waarnemingen. Ik herinner me ze altijd als een soort "Wilde Zwanen in ganzen kostuum"... Toentertijd hadden we ook de bevestiging van enkele halsband aflezingen die het stempel Taiga bevestigden.


Onderstaand een link met allemaal Finse rietganzen. Deze foto-site gooit kennelijk alles op een hoop maar er staan wel een paar mooie "echte" Taiga's maar ook Toendra's op. Met name foto.nr. 208 laat Taiga's zien zoals ik ze in mijn herinnering heb... als je die dan vergelijkt met 109....


Weet niet of deze link al bekend is, besproken is, maar ik voeg hem toch maar even toe... (kon hem in de discussie niet vinden...)


http://www.birdphoto.fi/lajikuvat/ansfab/index.php (http://www.birdphoto.fi/lajikuvat/ansfab/index.php)


met groet


fred prak
telpost haarzuilens


Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 28, 2010, 10:57:21 am
En hier een pdf (ingescand van origineel) van het artikel uit Limosa:
 
Leo van den Bergh 1985. Het voorkomen van de Taigarietgans in Nederland. Limosa 58: 17-22.
 
Veel leesplezier & groetjes,
 
Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 28, 2010, 11:17:56 am
Hoi Lutzen,
 
Hoe meer foto's, hoe meer vogels je blijft bestuderen in het rietganzen complex, prachtige duidelijke (maar variabele) foto's uit Schotland e.o.. En hoe meer de vogels (van Max en mij) waar je naar verwijst ook weer ter discussie gesteld kunnen worden.
 
Hieronder ook nog twee linkjes naar vogels, die of net wel net niet vallen zoals een fabalis moet zijn, wat vinden jij en anderen hiervan;
 
http://waarneming.nl/waarneming/view/45609906 (http://waarneming.nl/waarneming/view/45609906)
http://waarneming.nl/waarneming/view/46144664 (http://waarneming.nl/waarneming/view/46144664)
 
Ik denk dat de status zoals deze nu op waarneming.nl staat aangegeven als vrij algemeen nu inmiddels wel is ontkracht.
 
Groet, Justin
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 28, 2010, 13:15:03 pm
  • @Trinus
    Overigens ben ik wel benieuwd wat jij nu van die vogels vanJustin&Max vind:
    http://waarneming.nl/waarneming/view/46146100 (http://waarneming.nl/waarneming/view/46146100)
    [/l][/l]
Hoi Lutzen, ik zie hier geen overtuigende Taigarietganzen in. Ik zeg echter niet dat het geen Taigarietganzen zijn. Als ik de foto's bekijk lijkt het op een familiegroepje van 2 adulten en 2 jongen. Daarvan heeft 1 adult iets weg van een Taigarietgans. Mogelijk is dit de gent (=man), die zijn altijd wat steviger en daardoor lijkt die mogelijk nog het meest op een Taiga, zonder dat het er een hoeft te zijn. Pas als van een familiegroepje alle vogels voldoen aan het juiste signalement wordt ik enthousiast(er). Op basis van de foto's zou ik er geen Taigarietganzen van durven maken.
 
Hieronder ook nog twee linkjes naar vogels, die of net wel net niet vallen zoals een fabalis moet zijn, wat vinden jij en anderen hiervan;
 
http://waarneming.nl/waarneming/view/45609906 (http://waarneming.nl/waarneming/view/45609906)
http://waarneming.nl/waarneming/view/46144664 (http://waarneming.nl/waarneming/view/46144664)
Hoi Justin, op de foto's van de eerste link zijn drie eerste kj vogels te zien, dus vogels geboren in 2009. Ik zou hier geen Taigarietganzen van durven maken. De vogel van de tweede link zou een Taigarietgans kunnen zijn. Dit lijkt me ook een jong, dus ik zou daar ook voorzichtig mee zijn. 
 
 [/list]
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 28, 2010, 13:33:17 pm
Beste Trinus,
 
Dank. Dit waren en zijn de meest duidelijke/afwijkende vogels welke ik in de afgelopen 4 weken gezien heb in Oost-Brabant en de kop van Noord-Limburg bij het doorspitten van enorme concentraties rietganzen. Groepen Taigarietganzen zitten er gewoonweg niet meer in deze hoek. De laatste echte groep -een solitaire club- heb ik in 2002 gezien. Dit waren allemaal geelbekken.
Deze foto's en de mening die hierbij gezet worden, maken het wel evident dat ik al mijn individuen buiten groepen op onzeker ga zetten.
 
groet, Justin
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 28, 2010, 13:59:36 pm
Hoe meer foto's, hoe meer vogels je blijft bestuderen in het rietganzen complex, prachtige duidelijke (maar variabele) foto's uit Schotland e.o.. En hoe meer de vogels (van Max en mij) waar je naar verwijst ook weer ter discussie gesteld kunnen worden.
hoi Justin,
 
Ik moet bekennen dat ik me nog niet diep heb ingegraven in de juiste / goede kenmerken om beide soorten (Toendrarietgans <----> Taigarietgans) goed & eenduidig van elkaar te onderscheiden. Maar mede door jouw mailtje bekruipt mij een gevoel dat het onderscheid tussen beide soorten niet eenvoudig en/of eenduidig is. En al die foto's die jij en anderen becommentariëren als 'er tussen in' etc?
 
Volgens mijn filosofie moet je soorten goed & eenduidig van elkaar kunnen onderscheiden. Er mag er niet voortdurend discussie zijn of een bepaald individu nu tot soort A of soort B behoort. Een dergelijke discussie past bij ondersoorten. Een bekend voorbeeld is natuurlijk de ex-soort Baltische Mantelmeeuw. Bleek bij nadere studie te veel overlap in kenmerken te vertonen met Kleine Mantelmeeuw.
 
Andere bekende voorbeelden van soorten die in Nederland voorkomen:
(1) Stormmeeuw (heinei versus canus),
(2) Bonte Strandloper (schinzii versus alpina versus arctica versus centralis),
(3) Rosse Grutto (lapponica versus taymyrensis),
(4) Tureluur (totanus versus robusta versus brittanica),
(5) Grutto (limosa versus islandica),
(6) Kanoetstrandloper (canutus versus islandica),
etc.
 
En ik krijg sterk de indruk dat de discussie over de herkenning van Taigarietgans versus Toendrarietgans hier overeenkomsten mee heeft. Dus de uitersten van beide ondersoorten zijn wel goed te herkennen cq individuen in zomerkleed etc cq individuen in een bepaald biotoop / van een bepaald gedrag etc. Maar dus ook vaak niet / nauwelijks / moeizaam.
 
Argumenten die erop duiden dat het beter is om te spreken van één soort (Rietgans Anser fabalis)?
 
En tot slot nog even (via knip/plak) de letterlijke tekst uit: Sangster G., C.J. Hazevoet, A.B. van den Berg, C.S. Roselaar &[/font] R. Sluys 1999. DUTCH AVIFAUNAL LIST: SPECIES CONCEPTS, TAXONOMIC INSTABILITY, AND TAXONOMIC CHANGES IN 1977-1998. Ardea 87: 139-165.
 
"Anser fabalis Taiga Bean Goose Taigarietgans Anser serrirostris Tundra Bean Goose
Toendrarietgans Taiga Bean Goose and Tundra Bean Goose are specifically distinct (Sangster & Oreel 1996; King 1997; Persson 1997; Wells 1998) based on differences in proportions, vocalisations, feeding habitat and diet, photosensitivity, activity pattern, behaviour, phenology and responses to periods of extreme cold (Berry 1938; Coombes 1951; Mathiasson 1963; Huyskens 1977; 1986; Van Impe 1980; Kurechi et al. 1983; Van den Bergh 1985; Barthel 1989; 1995; Burgers et al. 1991; Miyabayashi et al. 1994). Ringing recoveries suggest that Taiga Bean Goose and Tundra Bean Goose have allopatric breeding distributions (Burgers et al. 1991) and there is no evidence for 'intergradation' (Sangster & Oreel 1996). In both Taiga Bean Goose and Tundra Bean Goose, geographic variation in size (Johansen 1945; Delacour 1951; Cramp & Simmons 1977; Roselaar 1977) is consistent with a clinal variation pattern (Sangster & Oreel 1996); therefore, johanseni and middendorffi are included in A. fabaiis; rossicus is included in A. serrirostris (Sangster & OreeI 1996)."
........
Kloppen alle beweringen nog steeds?
.......
Vriendelijke groeten,
Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 28, 2010, 14:24:15 pm
Als vogelaar met een verleden in Oost-Groningen in de jaren '80 heb ik ze nog steeds op mijn "netvlies" staan, de Taiga's van toen. Ik volg deze zeer interessante discussie echter niet precies genoeg om van alle actuele details op de hoogte te zijn. Recent heb ik wel contact gezocht met Berend Voslamber over onze toenmalige Taiga waarnemingen. Ik herinner me ze altijd als een soort "Wilde Zwanen in ganzen kostuum"... Toentertijd hadden we ook de bevestiging van enkele halsband aflezingen die het stempel Taiga bevestigden. (....). fred prak telpost haarzuilens
moi Fred,
 
Ik zat nog eens even wat te lezen in het prachtige standaardwerk 'Goose Populations of the Western Palearctic' en daarin vond ik bijgaand figuur. Het figuur illustreert heel mooi dat er in die jaren regelmatig flinke aantallen Taigarietganzen in Nederland zaten (zeker tijdens de strenge winters). Het figuur illustreert bovendien dat na pakweg 1990 nauwelijks substantiële aantallen in Nederland werden geteld, in ieder geval tijdens de midwintertelling in januari.
 
Groetjes, Klaas
 
PS: zie http://www.geese.org/gsg/goose_populations.html (http://www.geese.org/gsg/goose_populations.html) voor achtergronden over het boek 'Goose populations'.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 28, 2010, 14:42:00 pm
Zonet nog weer even op de kaartjes van de jaarlijkse watervogelrapporten van Sovon gekeken. En dan valt het toch erg op dat er een enorm gat zit tussen de waarnemingen in Nederland en die in Duitsland. Voor het gemak even de pagina's met de soortbespreking van Taigarietgans uit de twee meest recente Sovon-rapporten (winter 2004/05 en winter 2005/06) ingescand. Beide met uitgebreide stippenkaarten met de verspreiding van Taigarietgans in Nederland door de maanden heen (rapport van 2006/07 geeft alleen stippenkaarten van soorten als Soepeend [zeer dikke stip in de stad Groningen], Soepgans etc.). En dan komt natuurlijk de vraag op hoe dit alles met elkaar is te rijmen. Zeker als je bedenkt dat veel 'rietganzen' van de slaapplaats Bargerveen ook gebruik maken van het aangrenzende Duitsland. Lopen daar dan geen tellers rond, of ......
 
Beide recente Sovonrapporten stellen dat het totaal aan in Nederland overwinterende Taigarietganzen vermoedelijk wordt onderschat! Dus er zouden best nog wel eens veel (?) meer Taigarietganzen in Nederland kunnen overwinteren. En dat terwijl andere vogelaars ze maar niet kunnen vinden. 't Is wel duidelijk dat ook dit niet met elkaar is te rijmen.
 
Groetjes, Klaas
In de SOVON-rapporten over de winters 2004/05 en 2005/06 wordt inderdaad gesteld dat de aantallen Taigarietganzen worden onderschat cq als minimum moeten worden beschouwd. In het verslag over 2006/2007 staat totaal iets anders, namelijk dat door determinatieproblemen tellers de soort ten onrechte opgeven en dat de aantallen die in Nederland worden geteld niet passen in het Europese beeld. Men vraagt zich openlijk af of de (hoge) aantallen wel kloppen. Hoogstwaarschijnlijk zijn de teksten in alle drie gevallen door dezelfde persoon geschreven (Leo van den Bergh). Door hetgeen in het verslag over 2006/07 wordt geschreven wordt dat wat geschreven is in de rapporten over de 2 seizoenen daarvoor eigenlijk herroepen of minimaal ter discussie gesteld. Voortschrijdend inzicht? 
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 28, 2010, 14:44:54 pm
Hoe meer foto's, hoe meer vogels je blijft bestuderen in het rietganzen complex, prachtige duidelijke (maar variabele) foto's uit Schotland e.o.. En hoe meer de vogels (van Max en mij) waar je naar verwijst ook weer ter discussie gesteld kunnen worden.
"Anser fabalis Taiga Bean Goose Taigarietgans Anser serrirostris Tundra Bean Goose
Toendrarietgans Taiga Bean Goose and Tundra Bean Goose are specifically distinct (Sangster & Oreel 1996; King 1997; Persson 1997; Wells 1998) based on differences in proportions, vocalisations, feeding habitat and diet, photosensitivity, activity pattern, behaviour, phenology and responses to periods of extreme cold (Berry 1938; Coombes 1951; Mathiasson 1963; Huyskens 1977; 1986; Van Impe 1980; Kurechi et al. 1983; Van den Bergh 1985; Barthel 1989; 1995; Burgers et al. 1991; Miyabayashi et al. 1994). Ringing recoveries suggest that Taiga Bean Goose and Tundra Bean Goose have allopatric breeding distributions (Burgers et al. 1991) and there is no evidence for 'intergradation' (Sangster & Oreel 1996). In both Taiga Bean Goose and Tundra Bean Goose, geographic variation in size (Johansen 1945; Delacour 1951; Cramp & Simmons 1977; Roselaar 1977) is consistent with a clinal variation pattern (Sangster & Oreel 1996); therefore, johanseni and middendorffi are included in A. fabaiis; rossicus is included in A. serrirostris (Sangster & OreeI 1996)."
........
Kloppen alle beweringen nog steeds?
.......
[/l][/l][/l]
Jazeker kloppen die nog volgens CSNA regels.
In de taxonomische update in DB 31 nr 1, heeft middendorffii soortstatus verkregen
Titel: Re: rietgans, again...
Bericht door: Gerben Mensink op januari 28, 2010, 16:12:45 pm

Andere bekende voorbeelden van soorten die in Nederland voorkomen:
(1) Stormmeeuw (heinei versus canus),
(2) Bonte Strandloper (schinzii versus alpina versus arctica versus centralis),
(3) Rosse Grutto (lapponica versus taymyrensis),
(4) Tureluur (totanus versus robusta versus brittanica),
(5) Grutto (limosa versus islandica),
(6) Kanoetstrandloper (canutus versus islandica),
etc.

Vergeet asjeblieft de 'gele' kwikstaarten niet.
 
(Mooie analyse onderhand van het (taiga)rietganzenverhaal)  :duim:
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 28, 2010, 22:05:15 pm
Lupokatja: Dank voor je linkjes ziet er goed uit voor Taiga's (zwart dakje op de bovensnavel was iets wat ik vroeger als kenmerk in mijn schrift schreef zie ik nu weer terug op de foto's, sommige vogels in Norfolk vind ik overigens wel moeilijk).
 
Trinus: Dank voor je uitleg en commentaar op de vogels van Kraaijenberg. Ik begrijp niet waarom je van de drie vogels (van december) geen Taiga's durft te noemen omdat het vogels van 2009 zijn (snavelvorm en lange nek verdwijnen toch niet als ze ouder worden?), mogelijk heb ik iets gemist tav ID van jonge Rietganzen? sorry daarvoor.
Ik blijf de vogel(s) van afgelopen zondag (en dus ook in December) toch echt Taiga's vinden op basis van snavelvorm, lange nek, minder donkere nek en kop en grote (stak boven de Toendra's uit), maar goed mogelijk sta ik hier alleen in. Ik neem me zelf hierin (nog wel) serieus omdat ik geen moeite heb de zekere vogels op de linkjes van Taiga's snel op naam te brengen.
 
Ik begin me langzaam wel een beetje af te vragen wat het verschil is in de zekerheid van de ID van Taiga's zoals bijv. aangevoerd in de stukjes op de DB site en recentere vogels als Taiga's geclaimd. Langzaam komen we op een punt dat je alleen 100% overeenstemming krijgt bij de ID van een Taiga als er een (nek) ring om zit....
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Mars Muusse op januari 28, 2010, 22:32:00 pm
Citaat
Langzaam komen we op een punt dat je alleen 100% overeenstemming krijgt bij de ID van een Taiga als er een (nek) ring om zit....

Max, vergeet de 'families' niet. Misschien wel de belangrijkste weg voor onderzoek naar variabiliteit van adult vs juv?
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 28, 2010, 23:31:50 pm
Ik begrijp niet waarom je van de drie vogels (van december) geen Taiga's durft te noemen omdat het vogels van 2009 zijn (snavelvorm en lange nek verdwijnen toch niet als ze ouder worden?), mogelijk heb ik iets gemist tav ID van jonge Rietganzen? sorry daarvoor.
 
Ik begin me langzaam wel een beetje af te vragen wat het verschil is in de zekerheid van de ID van Taiga's zoals bijv. aangevoerd in de stukjes op de DB site en recentere vogels als Taiga's geclaimd. Langzaam komen we op een punt dat je alleen 100% overeenstemming krijgt bij de ID van een Taiga als er een (nek) ring om zit....
Hoi Max, deze 3 jongen lijken wat achterop in hun ontwikkeling ten opzichte van de meeste jonge Rietganzen. De pigmentering op de snavel lijkt nog niet begonnen. Ik zou dit soort vogels niet gebruiken om er Taigarietganzen "van te maken". De 3 jongen lijken alleen te zijn, als nou de ouders er eens bij op de foto gezet waren?
 
De kans om een Taigarietgans met een halsband in Nederland tegen te komen is nagenoeg nul. Van de 37 vogels die in de herfst van 2007 aan de Oder in Duitsland werden gevangen is bijvoorbeeld geen enkele in Nederland waargenomen. Ik zou me, net wat Mars schrijft, richten op het vinden van familiegroepjes waar alle individuen aan het juiste signalement voldoen. Dan zit je altijd goed.
 
Op bladzijde 15 van het volgende document kun je de Nederlandse ganzenvanger Kees Polderdijk zien met 1 van de gevangen en van een halsband voorziene Taigarietganzen: http://www.dda-web.de/downloads/texts/wvz/rundschreiben_wv07_standard.pdf (http://www.dda-web.de/downloads/texts/wvz/rundschreiben_wv07_standard.pdf)
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 29, 2010, 07:10:30 am
Het gevaar van familie ID is dat meer oranje in de snavel vererft binnen families Toendra's waardoor je ook familie Toendra's krijgt die oranje snavels hebben en als groepje in de groep gewone Toendra snavels lopen. Ook oogt oranje vaak "platter en groter" dan "donker met een bandje". Ik heb dit voor mezelf zo `uitgevonden" tijdens al mijn zoektochten en het is dus niet wetenschappelijk onderbouwd.
 
Toch opmerkelijk, we hebben bewezen Taiga´s ten westen van ons (komende vanuit het noord oosten) in Norfolk en ten oosten van ons (NO Duitsland) en toch vinden we de kans op een geringde Taiga nul?? Volgens mij hebben we wel wat soorten met ringen in NL die van veel verder komen en in kleinere aantallen om NL aanwezig zijn in een bepaalde periode van het jaar. Ik blijf zeggen dat we op een punt komen te kritisch te worden ten aanzien van vogels die er goed uitzien voor Taiga's..

Gr Max
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 29, 2010, 08:23:52 am
Nog een aanvulling:
 
Gezien de discussie kijk ik bijna dagelijks naar de opgevoerde foto's van Taiga's op waarn.nl, meestal zijn het Toendra's. Ik keek vanmorgen naar deze http://waarneming.nl/waarneming/view/46196445 (http://waarneming.nl/waarneming/view/46196445) in eerste instantie Toendr's maar kijk even naar de foto van de groep en de "slangenhals vogel links met een oranje snavel, die had ik wel wat beter willen zien...
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op januari 29, 2010, 10:05:35 am
Nog een aanvulling:
 
Gezien de discussie kijk ik bijna dagelijks naar de opgevoerde foto's van Taiga's op waarn.nl, meestal zijn het Toendra's. Ik keek vanmorgen naar deze http://waarneming.nl/waarneming/view/46196445 (http://waarneming.nl/waarneming/view/46196445) in eerste instantie Toendr's maar kijk even naar de foto van de groep en de "slangenhals vogel links met een oranje snavel, die had ik wel wat beter willen zien...
 
Groet Max

Meest recente ondezoek van Ruokonen uit Molecular Phylogenetics and Evolution 48 (2008) pp. 554-562  titel ; Taxonomy of the bean goose-pink-footed goose , is toch zeer de moeite waard om eens door te lezen.
Mede daarom mochten we middendorfii ook niet meer weglumpen zoals uit een post van Klaas wordt geciteerd .  "Kloppen alle beweringen nog steeds ? " Nee die kloppen niet meer , dit is achterhaald.
Uit het laatste onderzoek blijkt bv dat deze (onder)soort , voor mijn part former ondersoort zeer sterk uit de fylogenetische boom naar voren komt , zeker met een genetische afstand van 2,7 % t.o.v. de clade waar fabilis wordt neergezet (zie fig. 2).
De verschillen tussen brachyrhynchus en fabilis zijn overduidelijk. Ik weet het , sequenties vergelijken daar hebben we in het veld niet zo veel aan. Maar kijk eens naar de verschillen in snavelgrootte : brach. gem 45.8 mm en fabilis 61.5 mm , weliswaar met SD van 4.24 , maar toch ?  Een verschil van ruim 1,5 cm .Daar moet goed mee te werken zijn in het veld.
 
mvg
 
Herman van der Klis
 
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 29, 2010, 10:41:16 am
De verschillen tussen brachyrhynchus en fabilis zijn overduidelijk. Ik weet het , sequenties vergelijken daar hebben we in het veld niet zo veel aan. Maar kijk eens naar de verschillen in snavelgrootte : brach. gem 45.8 mm en fabilis 61.5 mm , weliswaar met SD van 4.24 , maar toch ?  Een verschil van ruim 1,5 cm .Daar moet goed mee te werken zijn in het veld.
Maar daar heeft toch ook niemand moeite mee, met de determinatie van Kleine Rietgans, het zit in wat onder de term rietgans geschaard wordt (rossicus, fabalis en middendorfii).
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 29, 2010, 11:16:10 am
Ik heb inmiddels bij Gert Ottens (voormalig Drent) de vraag neergelegd of er personen zijn die hij kent met (zo recent mogelijke) foto's van Taiga Rietganzen in het oosten van het land (Drenthe). Gert gaat zijn best doen en vertelde dat hij mensen kende die zich in die provincie ook bezighielden met deze problematiek (o.a. Fochelorveen). We zullen zien.
 
Ook heb ik ooit (paar jaar geleden) een CDrom van Theo Bakker gezien met vele recente digi's van rietganzen uit de noordelijke provincies waar hij geen naam op plakte om later wat mee te doen. Theo eens vragen.
 
Ik hoop dat we toch kunnen nagaan hoe goed de ID is geweest in de periodes dat we nog niet zo met deze materie bezig waren en dat verondersteld werd dat de Taiga overwinteringsplekken kende in het (noord) oosten van NL. Als je het verleden ontrafeld geeft dat je een beter beeld van het, en de mogelijkheden in, het heden (mijn god wat een stichtelijke woorden :angel: )
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op januari 29, 2010, 13:04:11 pm
De verschillen tussen brachyrhynchus en fabilis zijn overduidelijk. Ik weet het , sequenties vergelijken daar hebben we in het veld niet zo veel aan. Maar kijk eens naar de verschillen in snavelgrootte : brach. gem 45.8 mm en fabilis 61.5 mm , weliswaar met SD van 4.24 , maar toch ?  Een verschil van ruim 1,5 cm .Daar moet goed mee te werken zijn in het veld.
Maar daar heeft toch ook niemand moeite mee, met de determinatie van Kleine Rietgans, het zit in wat onder de term rietgans geschaard wordt (rossicus, fabalis en middendorfii).

Klopt , dus wat op moleculair niveau zeer goed te onderscheiden is , is blijkbaar dan in het veld ook goed te zien.
Zelfs op DNA-niveau is het lastig ,deze laatste 3 (rossicus, fabalis en middendorfii) op te lossen  en zitten dus ook wat krakkemikkig in 1 clade. Het onderstreept het probleem rond het fabilis-complex nog eens goed.
De taiga's laten een clinale variatie zien , die van west naar oost  (lichaamsgrootte en snavelgrootte) toeneemt zowel in taiga- als in toendragebieden. Ik denk , hoe kouder de gebieden waar ze thuis horen des te groter zijn de vogels.
In hoeverre dan de zeer grootsnaveligen ( middend.) die eigenijk in Azie behoren te overwinteren , dan toch (soms ?) hier verzeild raken ? (Wanneer ik sommige foto's bekijk.)
Hun broedgebied zit dicht tegen fabilis aan ondanks verschil in habitat. taiga- resp. toendragebieden. Deze vogels zouden dan in 't veld redelijk goed te herkennen zijn.
Tja , dan hebben we het een beetje gehad.
 
mvg
 
Herman van der Klis
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 29, 2010, 13:48:56 pm
Ik heb inmiddels bij Gert Ottens (voormalig Drent) de vraag neergelegd of er personen zijn die hij kent met (zo recent mogelijke) foto's van Taigarietganzen in het oosten van het land (Drenthe). Gert gaat zijn best doen en vertelde dat hij mensen kende die zich in die provincie ook bezighielden met deze problematiek (o.a. Fochteloërveen). We zullen zien. Ook heb ik ooit (paar jaar geleden) een CDrom van Theo Bakker gezien met vele recente digi's van rietganzen uit de noordelijke provincies waar hij geen naam op plakte om later wat mee te doen. Theo eens vragen. Ik hoop dat we toch kunnen nagaan hoe goed de ID is geweest in de periodes dat we nog niet zo met deze materie bezig waren en dat verondersteld werd dat de Taiga overwinteringsplekken kende in het (noord) oosten van NL. Als je het verleden ontrafeld geeft dat je een beter beeld van het, en de mogelijkheden in, het heden (mijn god wat een stichtelijke woorden). Groet Max
hoi Max,
Een buitengewoon goed idee om (weer) eens beter te kijken naar die (miljoenen?) foto's die Theo destijds heeft gemaakt. Ik weet nog goed dat Theo daar destijds (nog steeds?) fanatiek mee bezig was. Het is gewoon broodnodig om te achterhalen hoe goed / betrouwbaar de identificatie (destijds) was van Taigarietgans. Denk ook aan identificatieproblemen Matkop / Glanskop. Daar zijn in de vogeltelwereld ook (zeer) heftige discussies over gevoerd (deels nog steeds). En ook daar bestaan oudere boeken / tijdschriftartikelen / rapporten met verspreidingskaarten die achteraf niet blijken te kloppen / betwist worden etc. En ik vind het veelzeggend dat Theo er -destijds?- geen naam op wist te plakken (of in ieder geval nogal wat vogels zag waarbij dit maar niet / moeizaam ging).
 
Nog eens even wat beter gekeken in het wavo 2006-07 rapport. Bijgaand even een scan van de drie pagina's die over Taigarietgans gaan.
 
Via knip/plak: "De gegevens uit 2006/07 weken weinig af van voorgaande seizoenen en wijzen op een winterpopulatie van hooguit 4000 vogels (februari). Of er zoveel Taigarietganzen in ons land verblijven en of de trend en verspreiding een reëel beeld weergeven is onduidelijk. Determinatieperikelen zorgen ervoor dat vogels soms ten onrechte als Taigarietgans worden opgegeven, zo blijkt onder andere uit bestudering van in ons land gefotografeerde Taigarietganzen (anderzijds worden vogels mogelijk ook over het hoofd gezien). Bovendien past uitbreiding van het voorkomen in ons land niet bij de bevindingen in het oosten van Duitsland en Zweden, waar de vogels tenderen in zachte winters steeds noordelijker te overwinteren (T. Heinicke/ DDA)."
 
Nou, dat zal allemaal wel, maar als je vervolgens hoofdstuk 6 ('Monitoring ganzen en zwanen', pagina 39-43) doorleest blijft niets over van deze twijfel. In onderstaande pdf ook even twee pagina's uit dit hoofdstukje, zodat iedereen het zelf kan bekijken. Geen sprake van noten, sterretjes o.i.d. bij tabel 6.2. dat de aantallen Taigarietganzen misschien niet (helemaal) in overeenstemming zijn met de werkelijkheid o.i.d. Het is zelfs andersom! De maxima zijn hoger dan in de eerdere rapporten.
 
Via knip/plak: "Tot dusverre was het gebruikelijk in de watervogelrapporten om bij ganzen en zwanen uitsluitend de getelde aantallen te presenteren, onder de aanname dat deze aantallen representatief zijn voor de grootte van de in Nederland aanwezige populatie. (....) Gezien het kleine aandeel bijgeschatte gegevens en het belang van informatie over totale populaties, worden met ingang van dit rapport de seizoensmaxima van ganzen en zwanen in Nederland inclusief geschatte aantallen gegeven. Opgaven van seizoensmaxima wijken daarmee af van die in voorgaande rapporten." [/font]En wat is het gevolg? Nog meer Taigarietganzen in Nederland! Zie onderstaande vergelijking.[/font]
 
2002/03: 5900 (4900 in wavorapport 2005/06, tabel 8.1 pagina 63).
2003/04: 3800 (3600 in wavorapport 2005/06, tabel 8.1 pagina 63).
2004/05: 4500 (4200 in wavorapport 2005/06, tabel 8.1 pagina 63).
2005/06: 4800 (3800 in wavorapport 2005/06, tabel 8.1 pagina 63).
2006/07: 4000.
 
Dit rapport (wavo2006/07) is geschreven door de volgende personen (in alfabetische volgorde):
Jan Beekman
Leo van den Bergh
Loes van den Bremer
Fred Cottaar
Bart Ebbinge
Fred Hustings
Kees Koffijberg
Jeroen Nienhuis
Marc van Roomen
Jan Schoppers
Roy Slaterus
Leo Soldaat
Dirk Tanger
Jan-Willem Vergeer
Berend Voslamber
Erik van Winden
----------[/font]
Het kost enige moeite om de namenlijst van alle auteurs compleet te krijgen, want een aantal staan vermeld onder 'Sovon ganzen- en zwanenwerkgroep' en een aantal anderen staan vermeld als 'met medewerking van.' Maar uiteindelijk schrijven groepen geen teksten (ooit een groepje achter een PC zien zitten?), maar de personen waaruit zo'n groep bestaat.[/font]
 
In totaal dus 16 verschillende auteurs die volgens de normale regels van wetenschappelijke publicaties allemaal voor de volle 100% achter de informatie in deze teksten en tabellen etc. staan. [/font]Een van mijn leermeesters zei altijd: veel auteurs boven een publicatie betekent dat de publicatie breed wordt gedragen. En het doet er bij dit soort publicaties niet toe wie wat geschreven heeft (Trinus gaf in een eerdere bijdrage de suggestie dat Leo van den Bergh wellicht de teksten over de Taigarietgans had geschreven): daarom staat juist al deze namen erboven als auteurs.
 
Vriendelijke groeten,
 
Klaas van Dijk
 
(NB: het lukt me niet om '' te verwijderen. Excuses hiervoor.
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 29, 2010, 20:16:23 pm
En tot slot nog even (via knip/plak) de letterlijke tekst uit: Sangster G., C.J. Hazevoet, A.B. van den Berg, C.S. Roselaar & R. Sluys 1999. DUTCH AVIFAUNAL LIST: SPECIES CONCEPTS, TAXONOMIC INSTABILITY, AND TAXONOMIC CHANGES IN 1977-1998. Ardea 87: 139-165.
 
"Anser fabalis Taiga Bean Goose Taigarietgans Anser serrirostris Tundra Bean Goose
Toendrarietgans Taiga Bean Goose and Tundra Bean Goose are specifically distinct (Sangster & Oreel 1996; King 1997; Persson 1997; Wells 1998) based on differences in proportions, vocalisations, feeding habitat and diet, photosensitivity, activity pattern, behaviour, phenology and responses to periods of extreme cold (Berry 1938; Coombes 1951; Mathiasson 1963; Huyskens 1977; 1986; Van Impe 1980; Kurechi et al. 1983; Van den Bergh 1985; Barthel 1989; 1995; Burgers et al. 1991; Miyabayashi et al. 1994). Ringing recoveries suggest that Taiga Bean Goose and Tundra Bean Goose have allopatric breeding distributions (Burgers et al. 1991) and there is no evidence for 'intergradation' (Sangster & Oreel 1996). In both Taiga Bean Goose and Tundra Bean Goose, geographic variation in size (Johansen 1945; Delacour 1951; Cramp & Simmons 1977; Roselaar 1977) is consistent with a clinal variation pattern (Sangster & Oreel 1996); therefore, johanseni and middendorffi are included in A. fabaiis; rossicus is included in A. serrirostris (Sangster & OreeI 1996)."
........
Kloppen alle beweringen nog steeds?
.......
Vriendelijke groeten,Klaas
Volgens mij kloppen die nog in zoverre dat dit de tot nu toe gangbare indeling was. De gangbare indeling tot nu toe is:
- Toendrarietgans (Anser serrirostris) met 2 ondersoorten, van west naar oost: rossicus en serrirostris;
- Taigarietgans (Anser fabalis) met 3 ondersoorten, van west naar oost: fabalis, johanseni en middendorfii.
Ik heb deze gangbare indeling schematisch op een kaartje gezet (BeanGooseOld), de grenzen zijn dus niet exact! De verschillende soorten heb ik verschillend gekleurd.
 
Het artikel van Ruokonen geeft volgens mij aanleiding om de zaak nu anders te bekijken. Volgens Ruokonen is de ondersoort Anser fabalis middendorffi een soort: Anser middendorffi. De drie andere vormen zijn in hun visie allemaal een ondersoort van de "rietgans" Anser fabalis, namelijk Anser fabalis rossicus, Anser fabalis serrirostris en Anser fabalis fabalis. Ik heb deze indeling ook op een kaartje gezet (BeanGooseNew). Dit kaartje is zo exact mogelijk overgenomen uit Ruokonen 2008. Dit is toch een hele andere indeling dan tot nu toe gangbaar was. Eén ondersoort, namelijk Anser fabalis johanseni, bestaat in hun visie zelfs helemaal niet eens.
 
Uit het kaartje in het artikel blijkt m.i. ook dat de verspreidingsgebieden van Anser fabalis serrirostris en Anser middendorffii dermate ver naar het oosten liggen dat die redelijkerwijs niet in West-Europa verwacht mogen worden. De ondersoorten waar we in West-Europa mee te maken hebben zijn dan dus slechts 2, namelijk Anser fabalis fabalis en Anser fabalis rossicus. Eigenlijk weer net als vroeger dus. 
 
 
 
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 29, 2010, 20:33:05 pm
In totaal dus 16 verschillende auteurs die volgens de normale regels van wetenschappelijke publicaties allemaal voor de volle 100% achter de informatie in deze teksten en tabellen etc. staan. Een van mijn leermeesters zei altijd: veel auteurs boven een publicatie betekent dat de publicatie breed wordt gedragen.
Dat is maar net hoe je het bekijkt. Je zou ook kunnen zeggen dat bij veel auteurs iedereen maar voor bijvoorbeeld 1/16 deel verantwoordelijk is voor de inhoud. Ook komt het voor dat personen uit een verschillend vakgebied samen een artikel schrijven, bijvoorbeeld biologen en virologen over griepzwanen. Dan kan iedereen ook niet voor 100% achter de inhoud van het volledige artikel staan, maar alleen maar voor dat wat geschreven is over zijn eigen vakgebied.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 29, 2010, 21:05:05 pm
De verschillen tussen brachyrhynchus en fabilis zijn overduidelijk. Ik weet het , sequenties vergelijken daar hebben we in het veld niet zo veel aan. Maar kijk eens naar de verschillen in snavelgrootte : brach. gem 45.8 mm en fabilis 61.5 mm , weliswaar met SD van 4.24 , maar toch ?  Een verschil van ruim 1,5 cm .Daar moet goed mee te werken zijn in het veld.
Maar daar heeft toch ook niemand moeite mee, met de determinatie van Kleine Rietgans, het zit in wat onder de term rietgans geschaard wordt (rossicus, fabalis en middendorfii).

Klopt , dus wat op moleculair niveau zeer goed te onderscheiden is , is blijkbaar dan in het veld ook goed te zien.
Zelfs op DNA-niveau is het lastig ,deze laatste 3 (rossicus, fabalis en middendorfii) op te lossen  en zitten dus ook wat krakkemikkig in 1 clade. Het onderstreept het probleem rond het fabilis-complex nog eens goed.
De taiga's laten een clinale variatie zien , die van west naar oost  (lichaamsgrootte en snavelgrootte) toeneemt zowel in taiga- als in toendragebieden. Ik denk , hoe kouder de gebieden waar ze thuis horen des te groter zijn de vogels.
In hoeverre dan de zeer grootsnaveligen ( middend.) die eigenijk in Azie behoren te overwinteren , dan toch (soms ?) hier verzeild raken ? (Wanneer ik sommige foto's bekijk.)
Hun broedgebied zit dicht tegen fabilis aan ondanks verschil in habitat. taiga- resp. toendragebieden. Deze vogels zouden dan in 't veld redelijk goed te herkennen zijn.
Tja , dan hebben we het een beetje gehad.
 
mvg
 
Herman van der Klis

Waarom zijn de taiga's dan overwegend groter dan de toendra's? op de toendra is het toch gemiddeld genomen kouder dan op de taiga?
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 29, 2010, 21:14:39 pm
Toendra, kouder dus minder eten en minder lichaam om warm te stoken?
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 29, 2010, 21:29:57 pm
Toendra, kouder dus minder eten en minder lichaam om warm te stoken?

maar dan gaat het verhaal toch niet op dat taiga's in koudere gebieden groter zijn?
dan zouden die toch ook kleiner zijn?
 
en een groter lichaam is makkelijker warm te houden (verhouding inhoud t.o.v. oppervlakte) (ijsbeer bv)
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 29, 2010, 21:30:28 pm
Hoi Lutzen,
 
Hoe meer foto's, hoe meer vogels je blijft bestuderen in het rietganzen complex, prachtige duidelijke (maar variabele) foto's uit Schotland e.o.. En hoe meer de vogels (van Max en mij) waar je naar verwijst ook weer ter discussie gesteld kunnen worden.
 
Hieronder ook nog twee linkjes naar vogels, die of net wel net niet vallen zoals een fabalis moet zijn, wat vinden jij en anderen hiervan;
 
http://waarneming.nl/waarneming/view/45609906 (http://waarneming.nl/waarneming/view/45609906)
http://waarneming.nl/waarneming/view/46144664 (http://waarneming.nl/waarneming/view/46144664)
 
Ik denk dat de status zoals deze nu op waarneming.nl staat aangegeven als vrij algemeen nu inmiddels wel is ontkracht.
 
Groet, Justin

Ik zou daar een paar weken geleden zonder problemen Taigas van gemaakt hebben en zie eerlijk gezegd ook nu nog niet heel veel reden om daar heel erg te twijfelen, al kan dat nog komen natuurlijk. De vogels zouden zonder problemen passen binnen de groep Taigas (zeg ik dan nog maar) die vorige winter in het Luisbroek zat. Een aantal van de wat langnekkerige exemplaren uit die groep:
 
http://waarneming.nl/waarneming/view/46203982 (http://waarneming.nl/waarneming/view/46203982)
 
Als Taiga ingevoerde vogels van vandaag lijken me ook in orde, de specs. zijn inderdaad moeilijk. Ben benieuwd of je ook het gevoel krijgt dat 2 (onder)soorten eigenlijk niet genoeg is :)
 
Lutzen
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 29, 2010, 21:39:24 pm
Uit het kaartje in het artikel blijkt m.i. ook dat de verspreidingsgebieden van Anser fabalis serrirostris en Anser middendorffii dermate ver naar het oosten liggen dat die redelijkerwijs niet in West-Europa verwacht mogen worden. De ondersoorten waar we in West-Europa mee te maken hebben zijn dan dus slechts 2, namelijk Anser fabalis fabalis en Anser fabalis rossicus. Eigenlijk weer net als vroeger dus.

Voor wie zin heeft dat soort oostelijke vogels te claimen (ik niet) is onderstaande link wellicht nuttig. China moet een echt rampgebied zijn voor rietganzen-kijkers.
 
http://www.wwfchina.org/birdgallery/birdpic.shtm?booknum=70&page=0 (http://www.wwfchina.org/birdgallery/birdpic.shtm?booknum=70&page=0)
 
Lutzen
Titel: Re: rietgans, again...
Bericht door: Weia op januari 29, 2010, 22:13:26 pm
Uit het kaartje in het artikel blijkt m.i. ook dat de verspreidingsgebieden van Anser fabalis serrirostris en Anser middendorffii dermate ver naar het oosten liggen dat die redelijkerwijs niet in West-Europa verwacht mogen worden. De ondersoorten waar we in West-Europa mee te maken hebben zijn dan dus slechts 2, namelijk Anser fabalis fabalis en Anser fabalis rossicus. Eigenlijk weer net als vroeger dus.
Dat zou het wel wat eenvoudiger maken, tenzij je ondersoortenlijstjes je-van-het vindt. In een mooie publicatie van Sovon over trekvogels die ik vandaag zag, staat een kaartje van een gezenderde gans die naar dat schiereiland net ten westen van de (nieuwe) grens rossicus/serrirostris ging. Dus ik zou niet te hard zeggen dat serrirostris redelijkerwijs niet hier zou kunnen komen. Bij jouw kaartje van de huidige indeling ligt de rode lijnzelfs westelijk van dat schiereiland...
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 29, 2010, 22:19:49 pm
Bij jouw kaartje van de huidige indeling ligt de rode lijnzelfs westelijk van dat schiereiland...
Er staat ook bij dat dat kaartje schematisch is. Er moet geen exacte waarde worden gehecht aan de grenzen die op dat kaartje staan.
 
In een mooie publicatie van Sovon over trekvogels die ik vandaag zag, staat een kaartje van een gezenderde gans die naar dat schiereiland net ten westen van de (nieuwe) grens rossicus/serrirostris ging.
Welke ganzensoort betreft dit?
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op januari 29, 2010, 23:09:40 pm
De verschillen tussen brachyrhynchus en fabilis zijn overduidelijk. Ik weet het , sequenties vergelijken daar hebben we in het veld niet zo veel aan. Maar kijk eens naar de verschillen in snavelgrootte : brach. gem 45.8 mm en fabilis 61.5 mm , weliswaar met SD van 4.24 , maar toch ?  Een verschil van ruim 1,5 cm .Daar moet goed mee te werken zijn in het veld.
Maar daar heeft toch ook niemand moeite mee, met de determinatie van Kleine Rietgans, het zit in wat onder de term rietgans geschaard wordt (rossicus, fabalis en middendorfii).

Klopt , dus wat op moleculair niveau zeer goed te onderscheiden is , is blijkbaar dan in het veld ook goed te zien.
Zelfs op DNA-niveau is het lastig ,deze laatste 3 (rossicus, fabalis en middendorfii) op te lossen  en zitten dus ook wat krakkemikkig in 1 clade. Het onderstreept het probleem rond het fabilis-complex nog eens goed.
De taiga's laten een clinale variatie zien , die van west naar oost  (lichaamsgrootte en snavelgrootte) toeneemt zowel in taiga- als in toendragebieden. Ik denk , hoe kouder de gebieden waar ze thuis horen des te groter zijn de vogels.
In hoeverre dan de zeer grootsnaveligen ( middend.) die eigenijk in Azie behoren te overwinteren , dan toch (soms ?) hier verzeild raken ? (Wanneer ik sommige foto's bekijk.)
Hun broedgebied zit dicht tegen fabilis aan ondanks verschil in habitat. taiga- resp. toendragebieden. Deze vogels zouden dan in 't veld redelijk goed te herkennen zijn.
Tja , dan hebben we het een beetje gehad.
 
mvg
 
Herman van der Klis

Waarom zijn de taiga's dan overwegend groter dan de toendra's? op de toendra is het toch gemiddeld genomen kouder dan op de taiga?

De taiga's en toendra's zitten niet in dezelfde cline en bovendien zijn  het ook twee verschillende en waarschijnlijk ook onafhankelijk van elkaar ontstane soorten. Alhoewel dit laatste niet alles zegt bij dergelijke zeer nauw verwante taxa. Kijken we binnen 1 cline , dan gaat het wel op.
Hoe exact de temperatuursverloop is binnen deze longitidunale cline kan ik even niet helemaal staven. Maar kijkend naar de kaartprojectie lijkt het mij dat de temperaturen in Noord Siberie (rossicus,serrirostris) over het algemeen een stuk lager liggen dan in de Scandinavische landen (fabalis).
Over het algemeen kun je zo wie zo stellen dat organismen binnen een cline ,die in koudere streken voorkomen over het algemeen een grotere lichaamsgrootte hebben dan hun (nauw) verwante taxa in de gematigde streken. Kijk maar naar beren , vissen , goudvinken , putters , barmsijzen enz...
 
Alleen loopt hier nog een (apart van lichaamsgrootte ?) adaptief verhaal doorheen , wanneer we kijken naar de snavelgrootte , waarin te zien is dat bij de bean en de middendorff's ganzen , die in de taiga broeden een grotere snavel hebben dan de bean en de pink-footed ganzen die in de toendra's broeden.
 
mvg
 
Herman van der Klis
Titel: Re: rietgans, again...
Bericht door: Weia op januari 30, 2010, 10:18:23 am
Bij jouw kaartje van de huidige indeling ligt de rode lijnzelfs westelijk van dat schiereiland...
Er staat ook bij dat dat kaartje schematisch is. Er moet geen exacte waarde worden gehecht aan de grenzen die op dat kaartje staan.
 
In een mooie publicatie van Sovon over trekvogels die ik vandaag zag, staat een kaartje van een gezenderde gans die naar dat schiereiland net ten westen van de (nieuwe) grens rossicus/serrirostris ging.
Welke ganzensoort betreft dit?
Ik zie het plaatje zó voor me, maar het staat niet in die publicatie... En ik kan helemaal niet bedenken waar het dan geweest kan zijn. Vergeet m'n opmerking maar.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 31, 2010, 18:07:36 pm
Zweden dus Taiga's? http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31661 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31661) ??
 
Ben benieuwd wat we in NL er van zouden maken, zit trouwens volgens mij ook een verscholen Kleine Riet tussen.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 31, 2010, 18:12:21 pm
zit trouwens volgens mij ook een verscholen Kleine Riet tussen.
Zelfs 2 en een paar Kolganzen natuurlijk.
De meeste vogels zien er goed uit voor Taigarietganzen, let ook eens op het formaat ten opzichte van de Kleine Rieten. En dat zijn ook geen kleine jongens.
 
Titel: Re: rietgans, again...
Bericht door: frankneijts op januari 31, 2010, 19:01:37 pm
zit trouwens volgens mij ook een verscholen Kleine Riet tussen.
Zelfs 2 en een paar Kolganzen natuurlijk.
De meeste vogels zien er goed uit voor Taigarietganzen, let ook eens op het formaat ten opzichte van de Kleine Rieten. En dat zijn ook geen kleine jongens.
Vooruit dan, ik doe er 3....... 8)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 01, 2010, 14:30:49 pm
Beste mensen,
 
Het afgelopen weekend het artikel 'Taxonomy of the bean goose-pink-footed goose' (M. Ruokonen, K. Litvin & T. Aarvak 2008, Molecular Phylogenetics and Evolution 48: 554-562) eens even rustig van A-Z doorgelezen, inclusief de bijlage.
 
Vooral de bijlage was erg nuttig om te lezen. Want wat blijkt:
 
* in totaal zijn er DNA monsters van 146 verschillende Rietganzen (dus excl. Kleine Rietgans) '... collected from breeding areas during ringing projects, from hunters or from museums.' [letterlijke tekst van artikel, pagina 556]. Ik kan hier niet anders uit concluderen dat dus alle 146 monsters betrekking hebben op (zekere) broedvogels en/of niet-vliegvlugge jongen. Kleine Rietgans laat ik hieronder buiten beschouwing.
 
Maar uit bijlage 1 (tabel S1, prachtig dat hij is opgenomen) valt te lezen:
1. van 5 vogels is geen datum bekend (dus geen dag, maand of jaar, laat staan een seizoen).
2. van 28 vogels is alleen het jaar bekend (dus geen dag en geen maand). Dit geldt bijvoorbeeld voor alle monsters van Kamchatka (11 middendorffii, 8 serrirostris, allemaal uit het jaar 2000).
3. alle 12 vogels (allemaal middendorffii) uit/van Khabarovsk ('Amur' in de hoofdtekst) zijn uit 'april 2000'. Dat is m.i. niet het broedseizoen.
4. 7 vogels uit Tomsk Oblast zijn verzameld op 3 of 4 mei 2002 (4 middendorffii, 3 fabalis) en een achtste vogel uit Tomsk Oblast (middendorffii) is verzameld in 'early May 1907'. Dat is m.i. ook niet in het broedseizoen.
5. er zijn diverse monsters van vogels laat in de zomer / herfst, bijvoorbeeld 24 augustus 1985, 29 september 1886, 14 september 1886, 10 september 1905. Is m.i. allemaal ver na het broedseizoen en heeft dus m.i. geen betrekking op broedvogels.
 
Later meer, maar de voorlopige conclusie van mij is wel dat het artikel slechts deels betrekking heeft op 'zekere broedvogels'.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 01, 2010, 15:15:36 pm
Beste mensen,
 
Het afgelopen weekend het artikel 'Taxonomy of the bean goose-pink-footed goose' (M. Ruokonen, K. Litvin & T. Aarvak 2008, Molecular Phylogenetics and Evolution 48: 554-562) eens even rustig van A-Z doorgelezen, inclusief de bijlage.
 
Vooral de bijlage was erg nuttig om te lezen. Want wat blijkt:
 
* in totaal zijn er DNA monsters van 146 verschillende Rietganzen (dus excl. Kleine Rietgans) '... collected from breeding areas during ringing projects, from hunters or from museums.' [letterlijke tekst van artikel, pagina 556]. Ik kan hier niet anders uit concluderen dat dus alle 146 monsters betrekking hebben op (zekere) broedvogels en/of niet-vliegvlugge jongen. Kleine Rietgans laat ik hieronder buiten beschouwing.
 
Maar uit bijlage 1 (tabel S1, prachtig dat hij is opgenomen) valt te lezen:
1. van 5 vogels is geen datum bekend (dus geen dag, maand of jaar, laat staan een seizoen).
2. van 28 vogels is alleen het jaar bekend (dus geen dag en geen maand). Dit geldt bijvoorbeeld voor alle monsters van Kamchatka (11 middendorffii, 8 serrirostris, allemaal uit het jaar 2000).
3. alle 12 vogels (allemaal middendorffii) uit/van Khabarovsk ('Amur' in de hoofdtekst) zijn uit 'april 2000'. Dat is m.i. niet het broedseizoen.
4. 7 vogels uit Tomsk Oblast zijn verzameld op 3 of 4 mei 2002 (4 middendorffii, 3 fabalis) en een achtste vogel uit Tomsk Oblast (middendorffii) is verzameld in 'early May 1907'. Dat is m.i. ook niet in het broedseizoen.
5. er zijn diverse monsters van vogels laat in de zomer / herfst, bijvoorbeeld 24 augustus 1985, 29 september 1886, 14 september 1886, 10 september 1905. Is m.i. allemaal ver na het broedseizoen en heeft dus m.i. geen betrekking op broedvogels.
 
Later meer, maar de voorlopige conclusie van mij is wel dat het artikel slechts deels betrekking heeft op 'zekere broedvogels'.
 
Groetjes, Klaas

Hoi Klaas,
 
Zoals eerder aangegeven heb ik ook nogal wat problemen met dit paper. Bijv. mbt de her-determinaties (3.6):
 
* van de 39 middendorffi's waren er 3 oorspronkelijk als serrirostris gedetermineerd. Heb ik verder niet naar gekeken.
* van de 49 fabalissen waren er 3 oorspronkelijk als middendorffii gedetermineerd. Ik neem aan (gezien de lokatie, maar zonder dat echt hard te kunnen maken) dat dat die vogels uit Tomsk Oblast waren. Maar kijk bijv. eens naar de maten van nummer 19213!
* van de 34 rossicussen waren er 7 oorspronkelijk als fabalis gedetermineerd, 1 als kleine rietgans en 1 als onbekend. Die fabalissen zouden zo maar die 7 vogels van het Yugorsky peninsula kunnen zijn. In dat geval hadden ze voor mtDNA ROS2 oorspronkelijk 7 fabalissen en 10 rossicussen en is mij bijv. niet duidelijk waarom alleen de fabalissen zijn geherdetermineerd.
 
Al met al hebben zowel de auteurs als reviewers van dit paper m.i. nogal wat steken laten vallen. Je kunt toch niet alleen maar die vogels laten herdetermineren waarvan het fenotype niet met jou verwachting overeenkomt zonder de kwaliteit/validiteit van die herdeterminaties enigzins te onderbouwen? En hoe zit het nu precies met die morfologische analyse? Heeft die nu betrekking op de oorspronkelijke determinatie of niet? Met dat "Grouping of the individuals for morphological analyses was done primarily based on the original taxon identities" kun je alle kanten uit. Ik heb weinig tot geen verstand van die genetische analyses dus kan moeilijk beoordelen in hoeverre dit soort misser(tje)s de eindconclusie mbt soortstatus van middendorffi in gevaar brengen (denk van niet).
 
Lützen
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 01, 2010, 15:43:30 pm
zit trouwens volgens mij ook een verscholen Kleine Riet tussen.
Zelfs 2 en een paar Kolganzen natuurlijk.
De meeste vogels zien er goed uit voor Taigarietganzen, let ook eens op het formaat ten opzichte van de Kleine Rieten. En dat zijn ook geen kleine jongens.

Baseer je dat nu alleen op snavelkleur (+ formaat)? Vind ze voor de rest maar bitter weinig lijken op de Poolse of Schotse vogels (en veel meer op sommige Nederlandse vogels). Wil nog niet zeggen dat ik het zelf Toendra's vind overigens, als je op http://www.birdphoto.fi/lajikuvat/ansfab/index.php (http://www.birdphoto.fi/lajikuvat/ansfab/index.php) kijkt zie je natuurlijk zat vogels zonder opvallend lange nek of snavel.
 
Overigens is het aantal waarnemingen van Toendrarietganzen in Zweden de laatste jaren fors toegenomen, al is ook hier volgens mij onduidelijk in hoeverre dit een reeel fenomeen is of dat men anders (beter?) naar de vogels is gaan kijken. Ben benieuwd wat jullie maken van deze vogel:
 
http://www.artportalen.se/artportalen/gallery/images/swe/birds/2010/large/186275.jpg (http://www.artportalen.se/artportalen/gallery/images/swe/birds/2010/large/186275.jpg)
 
Lützen
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 01, 2010, 18:34:27 pm
Hoi Klaas, Zoals eerder aangegeven heb ik ook nogal wat problemen met dit paper. Bijv. mbt de her-determinaties (3.6):
 
* van de 39 middendorffi's waren er 3 oorspronkelijk als serrirostris gedetermineerd. Heb ik verder niet naar gekeken.
* van de 49 fabalissen waren er 3 oorspronkelijk als middendorffii gedetermineerd. Ik neem aan (gezien de lokatie, maar zonder dat echt hard te kunnen maken) dat dat die vogels uit Tomsk Oblast waren. Maar kijk bijv. eens naar de maten van nummer 19213!
* van de 34 rossicussen waren er 7 oorspronkelijk als fabalis gedetermineerd, 1 als kleine rietgans en 1 als onbekend. Die fabalissen zouden zo maar die 7 vogels van het Yugorsky peninsula kunnen zijn. In dat geval hadden ze voor mtDNA ROS2 oorspronkelijk 7 fabalissen en 10 rossicussen en is mij bijv. niet duidelijk waarom alleen de fabalissen zijn geherdetermineerd.
 
Al met al hebben zowel de auteurs als reviewers van dit paper m.i. nogal wat steken laten vallen. Je kunt toch niet alleen maar die vogels laten herdetermineren waarvan het fenotype niet met jou verwachting overeenkomt zonder de kwaliteit/validiteit van die herdeterminaties enigzins te onderbouwen? En hoe zit het nu precies met die morfologische analyse? Heeft die nu betrekking op de oorspronkelijke determinatie of niet? Met dat "Grouping of the individuals for morphological analyses was done primarily based on the original taxon identities" kun je alle kanten uit. Ik heb weinig tot geen verstand van die genetische analyses dus kan moeilijk beoordelen in hoeverre dit soort misser(tje)s de eindconclusie mbt soortstatus van middendorffi in gevaar brengen (denk van niet). Lützen
hoi Lützen,
 
Goed om te lezen dat jij ook dit soort kritiek op het artikel hebt. Ik begrijp het ook niet goed dat 'Molecular Phylogenetics and Evolution' (het tijdschrift zegt me verder niet zoveel en ik weet ook niet waar het ergens staat op van die geheime ranking lijstjes) dergelijke missers -kennelijk- zomaar heeft laten passeren. Jouw bovenstaande kritiekpunt had ik ook gelezen en ik was daar ook al over gestruikeld. ik ben het volkomen met je eens.
 
In zo'n artikel moet het:
(1) ondubbelzinnig duidelijk zijn dat het over broedvogels gaat. En daarbij met de kennis van anno 2008 (dus niet anno pakweg 1873 ofzo),
(2) ondubbelzinnig duidelijk zijn dat de DNA profielen betrekking hebben op het taxon waar je juist in geďnteresseerd bent (en daarbij past het niet om de taxonnaam achteraf maar wat aan te passen, omdat er iets niet lijkt te kloppen met je verwachtingen o.i.d.).
 
En er staat zelfs op pagina 559: 'In fact, the three individuals with fabalis type mtDNA in the West Siberian sample were collected in early May, suggesting that they were still on migration towards the breeding areas.' Waarheen? 1000 km of meer naar het oosten, naar het westen of naar het noorden?
 
Nog niet genoemd, maar wel van essentiëel belang is de opmerking (pagina 557) dat de vleugellengte bij 32% van de vogels (N=84) niet gemeten kon worden doordat 'the wings were not fully grown after moult.' Nalopen van tabel S1 leert dat het -kennelijk- gaat om 3-4 rossicus, 2 serrirostris, 1 middendorffii. En er staan veel Rietganzen in tabel S1 die midden juli zijn gevangen / geschoten o.i.d., maar waarvan geen enkele maat is genomen.
De vraag is of deze ruiende ganzen ook tot de locale broedvogels gerekend mogen worden. Volgens mij niet zondermeer. Ganzen ruien hun slagpennen tijdens het opgroeien van de jongen en de familie blijft dan gewoon bijeen. Monsters van dergelijke vogels is geen probleem (maar is er scherp op gelet dat er uitsluitend monsters van niet-verwante individuen zijn genomen?; staat m.i. niet in de methode), want dat ruien gebeurt wel ergens in de buurt.
 
Maar er zijn ook niet-broedende (Riet)ganzen en (Riet)ganzen waarvan het broedsel vroegtijdig mislukt. Dergelijke vogels ruien vaak in (zeer) grote groepen en kunnen gemakkelijk >1000 km vliegen naar een geschikte ruiplek. Denk aan in Zweden broedende Grauwe Ganzen die naar de Oostvaarderplassen komen om er de slagpennen te ruien. Een dergelijk fenomeen zal ongetwijfeld ook optreden bij Rietganzen. [bij Kleine Rietgans is dit vermoedelijk een minder groot of geen probleem omdat de populaties op 'eilanden' broeden. De Spitsbergen populatie vliegt vermoedelijk niet naar IJsland, Groenland of waar dan ook om er de slagpennen te ruien.]
 
Goed, dus nogal onbegrijpelijk voor mij om ook deze -kennelijke- ruiers zonder meer toe te rekenen tot 'locale broedvogels'.
 
* ik zit ook niet goed in de details van de genetische analyse. Wat me wel opvalt is dat er afwisselend over SER1a & SER1b / SER 1 (en ROS2a & ROS2b, en FAB1a & FAB1b) wordt gesproken. Maar blijft staan dat de hele genetische analyse natuurlijk staat en valt met de zekerheid tot welke (geografische) broedpopulatie ieder individu behoort. En dan kun je nog zulke high-tech analyse toepassen en nog zulke leuke stukjes schrijven over de statistische analyse, maar dat alles snijdt weinig hout als je eigenlijk niet weet tot welke (sub)populatie je monsters behoren.
 
* het artikel spreekt in de eerste zin over de soort 'Bean Goose Anser fabalis' en gebruikt deze soortsnaam ook elders in de inleiding. Maar achteraan in de discussie (twee na laatste en laatste alinea) wordt gesproken over twee soorten: 'Bean Goose Anser fabalis' en 'Middendorff's Goose Anser middendorffii'.
 
* de analyse van de maten (tabel 4, pagina 559) is erg dunnetjes, en dan druk ik me nog voorzichtig uit. (1) vaak erg lage steekproeven, dus dan is een statische analyse niet echt veelzeggend. (2) daarbij komt (zie hierboven) dat er flink wat indivduen zullen afvallen, omdat er geen / nauwelijks zekerheid is over de broedstatus. En ook hierdoor wordt het hele statistiekdeel hierover vaagjes / nietszeggend etc.
 
* het ontgaat mij waarom de snavellengte van Kleine Rietgans in figuur 4 (pagina 558) staat & wordt betrokken in de lineaire regressie. Wat blijft hiervan over als je een rechte lijn zou trekken door de andere punten (dus excl. Kleine Rietgans)? En hoe om te gaan met de snavellengtes van de vogels waaraan twijfel is of ze wel op de vindlocatie broeden? Zijn die hier weggelaten? Kun je zomaar dergelijke analyses doen met meerdere soorten? Wat als je de Grauwe Gans en de Kolgans er ook inzet?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 01, 2010, 20:57:42 pm
Hoi Klaas, zoals eerder aangegeven heb ik ook nogal wat problemen met dit paper. Bijv. mbt de her-determinaties (3.6):
 * van de 39 middendorffi's waren er 3 oorspronkelijk als serrirostris gedetermineerd. Heb ik verder niet naar gekeken.
* van de 49 fabalissen waren er 3 oorspronkelijk als middendorffii gedetermineerd. Ik neem aan (gezien de lokatie, maar zonder dat echt hard te kunnen maken) dat dat die vogels uit Tomsk Oblast waren. Maar kijk bijv. eens naar de maten van nummer 19213!
* van de 34 rossicussen waren er 7 oorspronkelijk als fabalis gedetermineerd, 1 als kleine rietgans en 1 als onbekend. Die fabalissen zouden zo maar die 7 vogels van het Yugorsky peninsula kunnen zijn. In dat geval hadden ze voor mtDNA ROS2 oorspronkelijk 7 fabalissen en 10 rossicussen en is mij bijv. niet duidelijk waarom alleen de fabalissen zijn geherdetermineerd.
 
Al met al hebben zowel de auteurs als reviewers van dit paper m.i. nogal wat steken laten vallen. Je kunt toch niet alleen maar die vogels laten herdetermineren waarvan het fenotype niet met jou verwachting overeenkomt zonder de kwaliteit/validiteit van die herdeterminaties enigzins te onderbouwen? En hoe zit het nu precies met die morfologische analyse? Heeft die nu betrekking op de oorspronkelijke determinatie of niet? Met dat "Grouping of the individuals for morphological analyses was done primarily based on the original taxon identities" kun je alle kanten uit. Ik heb weinig tot geen verstand van die genetische analyses dus kan moeilijk beoordelen in hoeverre dit soort misser(tje)s de eindconclusie mbt soortstatus van middendorffi in gevaar brengen (denk van niet). Lützen
hoi Lützen,
 
Zonet nog eens even het hoofdstukje 3.6 doorgelezen. Verbijsterend! En zeker gezien de belofte in de laatste alinea van de inleiding: 'Contrary to many previous studies carried out in the non-breeding areas, material for this study was collected from the breeding areas of the species.' Vanuit mijn eenvoudige optiek gaan we het dan hebben over 'zekere' broedvogels (dus ňf adulte ganzen die te linken zijn aan een nest of aan niet-vliegvlugge jongen ňf niet-vliegvlugge jongen; en in alle gevallen met een duidelijke vindlocatie).
 
De laatste alinea van hoofdstukje 3.6 is erg fraai (maar niet heus). 'Additionally, one individual, to which no subspecies was originally assigned, remained unclear. Independent re-identification and discriminant function analysis [yuk, toegepast op 1 vogel?] supported either taiga subspecies (fabalis or middendorfii) or serrirostris, but based on mtDNA this bird was placed [hoezo?] into the rossicus group (the sole carrier of ROS4 haplotype in Fig. 3).'  Zijn er nog meer smaken?
Natuurlijk is dit individu dus te herleiden via tabel S1. Een museumvogel (alle maten konden dus wel worden genomen), op 12 mei 1959 verzameld (=geschoten) in Krasnojarsk. De vraag komt ook op waar ergens in Krasnojarsk? Bij de stad Krasnojarsk? Ergens in de 'krais' Krasnojarsk (zeker 2000 km hoog)? Zie bv
http://en.wikipedia.org/wiki/File:Russian-regions.png (http://en.wikipedia.org/wiki/File:Russian-regions.png) Dus een vogel die nergens is thuis te brengen (en misschien ook nog wel 1000 km ofzo verwijderd is van zijn broedgebied) wordt dan toch maar als 'rossicus' gedetermineerd....
 
Ik heb een aantal van de meeuwengenetica-artikelen ook wel eens doorgespit (inclusief het complete proefschrift van Dorit Liebers, zie http://www.gull-research.org/papers/dissertation_dliebers.pdf (http://www.gull-research.org/papers/dissertation_dliebers.pdf)) maar dat ziet er toch heel wat gedegener uit.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 01, 2010, 23:13:40 pm
zit trouwens volgens mij ook een verscholen Kleine Riet tussen.
Zelfs 2 en een paar Kolganzen natuurlijk.
De meeste vogels zien er goed uit voor Taigarietganzen, let ook eens op het formaat ten opzichte van de Kleine Rieten. En dat zijn ook geen kleine jongens.

Baseer je dat nu alleen op snavelkleur (+ formaat)? Vind ze voor de rest maar bitter weinig lijken op de Poolse of Schotse vogels (en veel meer op sommige Nederlandse vogels). Wil nog niet zeggen dat ik het zelf Toendra's vind overigens, als je op http://www.birdphoto.fi/lajikuvat/ansfab/index.php (http://www.birdphoto.fi/lajikuvat/ansfab/index.php) kijkt zie je natuurlijk zat vogels zonder opvallend lange nek of snavel.
 
Overigens is het aantal waarnemingen van Toendrarietganzen in Zweden de laatste jaren fors toegenomen, al is ook hier volgens mij onduidelijk in hoeverre dit een reeel fenomeen is of dat men anders (beter?) naar de vogels is gaan kijken. Ben benieuwd wat jullie maken van deze vogel:
 
http://www.artportalen.se/artportalen/gallery/images/swe/birds/2010/large/186275.jpg (http://www.artportalen.se/artportalen/gallery/images/swe/birds/2010/large/186275.jpg)
 
Lützen
Ik kijk vooral naar het formaat. De vogels ogen fors en zijn in directe vergelijking met de Kleine Rietganzen fors groter. Tijdens het ringen van Kolganzen heb ik als bijvangst van zowel de Kleine Rietgans als de Toendrarietgans rond de 100 vogels geringd. De Toendrarietgans is slechts fractioneel groter dan de Kleine Rietgans. Dat blijkt ook uit de maten die in "Cramp" staan. De gewichten bijvoorbeeld:
"fabalis": M gem. 3198 (2690-4060) 68 vogels; F gem. 2843 (2220-3470) 58 vogels;
"rossicus": M gem. 2668 (1970-3390) 126 vogels; F gem. 2374 (2000-2800) 117 vogels;
"brachyrhynchus": M gem. 2490 (2180-2880) 46 vogels; F gem. 2197 (1790-2630) 42 vogels;
(het betreft allemaal vogels die in de winter in Nederland zijn gevangen)
De vogels op de foto zijn fors groter dan de Kleine Rietganzen, die zelfs klein ogen. De vogels hebben vrij lichte en lange snavels, alles bij elkaar voor mij geen reden om er Toendrarietganzen van te maken.
 
Die Zweedse vogel is een lastige. Hij staat alleen, dus geen vergelijkende vogels, heeft de snavel zijwaarts, maar oogt vrij groot. Lastig om daar met zekerheid iets van te zeggen.
 
 
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 01, 2010, 23:22:52 pm
Hoi Klaas,
 
Mooi dat je dat artikel van Ruokonen grondig hebt doorgespit. Aan het artikel schort blijkbaar nogal het een en ander. Wat is volgens jou de consequentie voor de situatie in Nederland als dit verhaal niet of te weinig zou deugen. Dat we dan voorlopig de oude situatie moeten handhaven? Dus met 3 ondersoorten Taigarietganzen, van west naar oost: fabalis, johanseni en middendorffii en 2 ondersoorten Toendrarietganzen: rossicus en serrirostris? Dat betekent dan dus dat johanseni blijft bestaan, terwijl daarover nauwelijks iets bekend is en Ruokonen op basis van hun onderzoek die (onder)soort helemaal niet hebben aangetroffen.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op februari 01, 2010, 23:27:29 pm
Citaat
Ik kijk vooral naar het formaat. De vogels ogen fors en zijn in directe vergelijking met de Kleine Rietganzen fors groter. Tijdens het ringen van Kolganzen heb ik als bijvangst van zowel de Kleine Rietgans als de Toendrarietgans rond de 100 vogels geringd. De Toendrarietgans is slechts fractioneel groter dan de Kleine Rietgans. Dat blijkt ook uit de maten die in "Cramp" staan. De gewichten bijvoorbeeld:
"fabalis": M gem. 3198 (2690-4060) 68 vogels; F gem. 2843 (2220-3470) 58 vogels;
"rossicus": M gem. 2668 (1970-3390) 126 vogels; F gem. 2374 (2000-2800) 117 vogels;
"brachyrhynchus": M gem. 2490 (2180-2880) 46 vogels; F gem. 2197 (1790-2630) 42 vogels;
(het betreft allemaal vogels die in de winter in Nederland zijn gevangen)

 
Hoe kan dan met zekeheid worden gezegd dat nu echt de juiste maten bij de juiste taxa staan en er niet een paar toendra's voor taiga's of omgekeerd zijn aangezien?
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 02, 2010, 10:40:22 am
Hoi Klaas, mooi dat je dat artikel van Ruokonen grondig hebt doorgespit. Aan het artikel schort blijkbaar nogal het een en ander. Wat is volgens jou de consequentie voor de situatie in Nederland als dit verhaal niet of te weinig zou deugen. Dat we dan voorlopig de oude situatie moeten handhaven? Dus met 3 ondersoorten Taigarietganzen, van west naar oost: fabalis, johanseni en middendorffii en 2 ondersoorten Toendrarietganzen: rossicus en serrirostris? Dat betekent dan dus dat johanseni blijft bestaan, terwijl daarover nauwelijks iets bekend is en Ruokonen op basis van hun onderzoek die (onder)soort helemaal niet hebben aangetroffen.
hoi Trinus,
 
Voor zover ik het kan doorgronden is figuur 3 de kern waar alles om draait en waar Ruokonen c.s. uiteindelijk hun conclusies op baseren.
 
In de eerste plaats (zie eerdere postings) moeten er dus flink wat DNA monsters uit worden verwijderd, omdat (lang) niet zeker is dat deze monsters betrekking hebben op broedvogels van die bepaalde locatie. Dat lijkt mij in ieder geval wel zo eerlijk. Hierdoor wordt de steekproefgrootte flink verkleind en zou het best eens kunnen dat dan de zeggingskracht (flink?) wordt verminderd.
 
Daarnaast is figuur 3 een model. Niet meer en niet minder. Dus gebaseerd op aannames (die dus lang niet allemaal waar hoeven te zijn) hoe iets zich in het verleden heeft afgespeeld. En bij dit verleden zijn er minimaal twee onbekende grootheden & aannames:
(1) ligging van refugia tijdens de ijstijden en de broedlocaties tijdens de ijstijden en hoe de verschillende populaties zich na de laatste ijstijd weer over Rusland hebben verspreid,
(2) ontwikkeling / snelheid / mate van constantheid etc. van de genetische verschillen (dus de spontane mutaties van bv C naar T, C naar A etc, zoals aangegeven in tabel 2 en 3) met daarbij de aanname dat de snelheid etc. bij Rietgans gelijk is aan andere soorten.
 
Beide onbekende grootheden moeten worden ingeschat (want je kunt nu eenmaal niet in de tijd teruggaan) en dat levert dus onzekerheden / aannames op. Daarbij moet je beseffen dat er bepaald geen overeenstemming is waar vroeger die refugia lagen, hoe groot ze waren en tijdens welke ijstijden etc. De meeuwenmensen (kijk bijvoorbeeld maar naar het prachtige overzichtsartikel http://www.gull-research.org/papers/liebers%202004%20proc.%20r%20lond%20b.pdf (http://www.gull-research.org/papers/liebers%202004%20proc.%20r%20lond%20b.pdf)) moesten bijvoorbeeld een refugium ergens op de Atlantische Oceaan uit de hoge hoed toveren. Het komt daarnaast regelmatig voor dat de genetische analyse van DNA-monsters niet overeenkomt met de situatie in het veld. Vroeger (heel vroeger, midden / eind jaren negentig) bestond nog het beeld dat we met behulp van de genetische analyse eindelijk eens te weten zouden komen hoe het nu zat. Nou, daar is men wel wat van teruggekomen hoor. Bij bijvoorbeeld Bonte Strandloper (ook zo'n mooie soort met allemaal ondersoorten) kwamen alleen maar onduidelijke resultaten uit het DNA onderzoek naar voren.
 
Heb jij eigenlijk ook het mooie boek 'The birds of Central Siberia' van Helena Rogacheva (uit 1992)? Daar staat ook een zeer uitgebreid stuk in over Rietganzen. Ruokonen ea. noemen ook een leuk artikel van Johan Mooij, maar dat lijkt voor mij onleesbaar te zijn: И. Моой, К. Цоклер 1999. Размышления о систематике, распространении и статусе гуменника Anser fabalis Latham , 1787) (англ.)  (http://www.goosegroup.ru/kasarka5.htm (http://www.goosegroup.ru/kasarka5.htm)).
 
O ja, ik vind het ook niet fraai om in tabel 4 man en vrouw over één kam te scheren. Want mannen zijn groter dan vrouwen, en dan kun je m.i. niet zomaar beide geslachten samen nemen in zo'n tabel met maten. Want wat zegt het dan eigenlijk?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 02, 2010, 11:11:25 am
Daarnaast is figuur 3 een model. Niet meer en niet minder. Dus gebaseerd op aannames (die dus lang niet allemaal waar hoeven te zijn) hoe iets zich in het verleden heeft afgespeeld. En bij dit verleden zijn er minimaal twee onbekende grootheden & aannames:
(1) ligging van refugia tijdens de ijstijden en de broedlocaties tijdens de ijstijden en hoe de verschillende populaties zich na de laatste ijstijd weer over Rusland hebben verspreid,
(2) ontwikkeling / snelheid / mate van constantheid etc. van de genetische verschillen (dus de spontane mutaties van bv C naar T, C naar A etc, zoals aangegeven in tabel 2 en 3) met daarbij de aanname dat de snelheid etc. bij Rietgans gelijk is aan andere soorten.
 
Beide onbekende grootheden moeten worden ingeschat (want je kunt nu eenmaal niet in de tijd teruggaan) en dat levert dus onzekerheden / aannames op.


Fig.3 is geen model, dat is eigenlijk rauwe data, weergegeven in een haplotype netwerk (iedere vogel heeft 1 mitochondriaal haplotype, een combinatie van allelen op het mtDNA). De voornaamste aanname hierin is de keuze van een mutatiemodel, maar dit zal hooguit minieme invloed op het resultaat uitoefenen, zeker bij een dergelijk simpel netwerk. Alleen bij de interpretatie van zo'n netwerk, komen dingen als refugia en mutatie snelheden om de hoek kijken, maar alleen als je hier conclusies over wilt trekken. In dit stuk is dat uberhaupt niet gebeurd.


Met de initiele identificaties zou het netwerk er alleen anders uitzien in de zin dat de taxa minder unieke haplotypes (cirkels met 1 type invulling) zouden hebben, vrnl. fabalis en rossicus zouden dan meer haplotypes delen.


Mannetjes en vrouwtjes zullen ze in de morfologische analyse wel niet hebben gescheiden vanwege de nu al lage sample sizes.
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 02, 2010, 11:13:03 am
Heb jij eigenlijk ook het mooie boek 'The birds of Central Siberia' van Helena Rogacheva (uit 1992)? Daar staat ook een zeer uitgebreid stuk in over Rietganzen. Ruokonen ea. noemen ook een leuk artikel van Johan Mooij, maar dat lijkt voor mij onleesbaar te zijn: И. Моой, К. Цоклер 1999. Размышления о систематике, распространении и статусе гуменника Anser fabalis Latham , 1787) (англ.)
Hoi Klaas, nee, dat boek van Helena Rogacheva heb ik niet. Dat artikel van Johan Mooij kun jij ook wel lezen, want het staat gewoon in het Engels in het tijdschrift Kазарка en het heet dan: Reflections on the systematics, distribution and status of Anser fabalis (Latham, 1787). Ook in dit stuk nauwelijks informatie over de al dan niet bestaande ondersoort johanseni. Ik zal het artikel wel even scannen en jou toesturen.
Ik herhaal nog wel de vraag in mijn vorige posting, namelijk wat na jou analyse van het stuk van Ruokonen volgens jou de relevantie cq de consequentie daarvan voor Nederland is.
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 02, 2010, 11:46:15 am
Fig.3 is geen model, dat is eigenlijk rauwe data, weergegeven in een haplotype netwerk (iedere vogel heeft 1 mitochondriaal haplotype, een combinatie van allelen op het mtDNA). De voornaamste aanname hierin is de keuze van een mutatiemodel, maar dit zal hooguit minieme invloed op het resultaat uitoefenen, zeker bij een dergelijk simpel netwerk. Alleen bij de interpretatie van zo'n netwerk, komen dingen als refugia en mutatie snelheden om de hoek kijken, maar alleen als je hier conclusies over wilt trekken. In dit stuk is dat uberhaupt niet gebeurd. Met de initiele identificaties zou het netwerk er alleen anders uitzien in de zin dat de taxa minder unieke haplotypes (cirkels met 1 type invulling) zouden hebben, vrnl. fabalis en rossicus zouden dan meer haplotypes delen. Mannetjes en vrouwtjes zullen ze in de morfologische analyse wel niet hebben gescheiden vanwege de nu al lage sample sizes.
hoi Jelmer,
Bedankt voor je uitleg en excuses dat ik het wat verkeerd had geďnterpreteerd. Toch maar eens even wat handboeken o.i.d. (of internet) raadplegen om echt goed te weten wat hier allemaal staat.
 
Tegelijk ben ik het niet met je eens dat Ruokonen ea. geen conclusies trekken. Hoofdstuk 4 noemt verschillende, (1) de genetische analyse bevestigt eerder morfologisch onderzoek dat Kleine Rietgans een aparte soort is, (2) de genetische analyse is geen ondersteuning voor onder andere CDNA/CSNA c.s. (Sangster et al. 1999, Sangster & Oreel 1996) dat de soort Rietgans kan worden opgesplitst in twee soorten (Toendrarietgans en Taigarietgans) en (3) de ondersoort middendorffii heeft dusdanige genetische verschillen dat het verdedigbaar zou zijn om deze populatie als soort te bestempelen (Anser middendorffii); iets wat ook wordt bevestigd door hun eigen morfologische data.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 02, 2010, 11:53:36 am
Hoi Klaas, nee, dat boek van Helena Rogacheva heb ik niet. Dat artikel van Johan Mooij kun jij ook wel lezen, want het staat gewoon in het Engels in het tijdschrift Kазарка en het heet dan: Reflections on the systematics, distribution and status of Anser fabalis (Latham, 1787). Ook in dit stuk nauwelijks informatie over de al dan niet bestaande ondersoort johanseni. Ik zal het artikel wel even scannen en jou toesturen. Ik herhaal nog wel de vraag in mijn vorige posting, namelijk wat na jou analyse van het stuk van Ruokonen volgens jou de relevantie cq de consequentie daarvan voor Nederland is.
hoi Trinus,
Ik ben nog aan het nadenken over jouw laatste vraag en had er daarom nog geen antwoord op gegeven. Dat komt deels omdat de genetische materie vrij taaie kost is om goed te doorgronden en ik de (fijnere) finesses ervan niet goed begrijp.
 
Blijft staan dat het -kennelijk- maar niet lukt om in deze winter (flink wat) goede foto's van onomstreden Taigarietganzen in Nederland te maken. En dat terwijl er legio goede fotografen in Nederland rondlopen en er bepaald geen gebrek aan ganzen is. Zonet nog even op birdpix.nl gekeken, maar daar was ook niets te vinden.
 
Alvast bedankt voor het maken van een scan van dit stuk.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 02, 2010, 12:37:12 pm
Tegelijk ben ik het niet met je eens dat Ruokonen ea. geen conclusies trekken. Hoofdstuk 4 noemt verschillende, (1) de genetische analyse bevestigt eerder morfologisch onderzoek dat Kleine Rietgans een aparte soort is, (2) de genetische analyse is geen ondersteuning voor onder andere CDNA/CSNA c.s. (Sangster et al. 1999, Sangster & Oreel 1996) dat de soort Rietgans kan worden opgesplitst in twee soorten (Toendrarietgans en Taigarietgans) en (3) de ondersoort middendorffii heeft dusdanige genetische verschillen dat het verdedigbaar zou zijn om deze populatie als soort te bestempelen (Anser middendorffii); iets wat ook wordt bevestigd door hun eigen morfologische data.


Ik was kennelijk niet helemaal duidelijk, excuses; ik bedoelde conclusies m.b.t. refugia (worden niet genoemd, toch?) of 'leeftijd' van de historische split tussen de verschillende taxa (waarvoor je een mutatie snelheid nodig hebt), die dingen waarvan jij noemde dat er noodzakelijkerwijs aannames over gemaakt zouden moeten worden. Uiteraard trekken ze wel andere conclusies  :)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 02, 2010, 19:45:47 pm
Ik was kennelijk niet helemaal duidelijk, excuses; ik bedoelde conclusies m.b.t. refugia (worden niet genoemd, toch?) of 'leeftijd' van de historische split tussen de verschillende taxa (waarvoor je een mutatie snelheid nodig hebt), die dingen waarvan jij noemde dat er noodzakelijkerwijs aannames over gemaakt zouden moeten worden. Uiteraard trekken ze wel andere conclusies
Mannetjes en vrouwtjes zullen ze in de morfologische analyse wel niet hebben gescheiden vanwege de nu al lage sample sizes.
hoi Jelmer,
In de discussie wordt wel degelijk -een beetje- ingegaan op ijstijden. Bv Ploeger (1968, Ardea 56, pagina 1-159, gratis down te loaden via de website www.nou.nu (http://www.nou.nu)) wordt aangehaald m.b.t wat er tijdens de laatste ijstijd gebeurd zou zijn ('... vicariant events during the last glacial.'). Maar het is wel een beetje een vaag stukje vol met enerzijds en anderzijds. Er er wordt wel wat gezegd over waar & wanneer diverse mogelijke 'splits' plaatsgevonden zouden kunnen hebben, maar concrete data / getallen worden niet echt duidelijk vermeld. Hoe meer is het lees, hoe vager het wordt.
 
Ik zie ook wel dat de steekproefgrootte van de maten (erg) klein is. Maar om dan maar man & vrouw samen te nemen, terwijl je weet dat (Kleine) Rietganzen sexueel dimorf zijn, tja..... De 'good old Cramp' (uit 1977) gooit beide geslachten ook niet op een hoop. Bovendien vermeldt Cramp zelfs expliciet bij de maten of de sex differences significant zijn of niet.
OK. Als ik het zou moeten beoordelen zou er een dikke streep door tabel 4 gaan! Maten moeten gescheiden naar geslacht worden opgegeven. Met daarbij in mijn achterhoofd dat je bij ganzen doodsimpel het geslacht met zekerheid kunt vaststellen.
 
Groetjes, Klaas
 
Titel: Re: rietgans, again...
Bericht door: theomuusse op februari 02, 2010, 20:40:34 pm
Hoi Lutzen,
 
Ik zou daar een paar weken geleden zonder problemen Taigas van gemaakt hebben en zie eerlijk gezegd ook nu nog niet heel veel reden om daar heel erg te twijfelen, al kan dat nog komen natuurlijk. De vogels zouden zonder problemen passen binnen de groep Taigas (zeg ik dan nog maar) die vorige winter in het Luisbroek zat. Een aantal van de wat langnekkerige exemplaren uit die groep:
 
http://waarneming.nl/waarneming/view/46203982 (http://waarneming.nl/waarneming/view/46203982)
 
Als Taiga ingevoerde vogels van vandaag lijken me ook in orde, de specs. zijn inderdaad moeilijk. Ben benieuwd of je ook het gevoel krijgt dat 2 (onder)soorten eigenlijk niet genoeg is :)
 
Lutzen

Daar zie ik toch echt wel echte taiga's hoor!!

De chinese vogels zet ik op serrirostris gezien de jizz en snavel...
De zweedse vogels lijken veel op de onze en noem ik toendra...

Theo
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 02, 2010, 22:45:07 pm
Vanwege gebrek aan tijd heb ik een poos dit topic niet in de gaten kunnen houden. Vanavond heb ik er even doorheen gelezen. Een voorbeeld van hoe een forum gebruikt zou moeten worden, chapeau! Leuk om te zien hoeveel artikelen langskomen die ik in de dikke map achter mij heb staan... hij wordt steeds dikker.

Bedankt Lutzen, Klaas en Trinus voor het uitpluizen c.q. ontmantelen van Ruokonen e.a.(2008). Als alpha zijn zulke artikelen abacadabra, maar nu begint er toch iets te dagen. Hetzelfde onderzoek uitvoeren met een grotere sample size zou toch nog altijd beter zijn dan onderzoek in de wintergebieden, denk ik.

Even wat reacties:
- Zoals al eerder aangegeven, zijn Sovons aantallen van taigarietgans te danken aan Leo van den Bergh en niet aan de mensen die nog meer in dat rijtje van 16 genoemd worden. Zijn artikelen vragen wat mij betreft toch echt om ondersteuning van ringmeldingen (100-en serrirostris in Oost-Drenthe, groepjes johansenii en een enkele middendorffi in het oosten. Prima, maar maakt het maar eens hard. Dat geldt overigens voor de hele problematiek).

- Het artikel in de Fitis over Spaarnwoude/Assendelft zou niet stroken met het idee dat er juist verdwaalde westelijke fabalissen zouden belanden. Ik heb het volledige artikel niet, maar volgens de omschrijving gaat het over oostelijke vogels.

- Theo, die Chinese vogels mag je niet op één hoop gooien. Het zijn voornamelijk plaatjes uit een overwinteringsgebied waar serrirostris en middendorffi gemixt worden. Er zitten zowel vogels met een uitgesproken lichte indruk, erg stevige hals en grote kop met diep gebogen en een stompe ondersnavel tussen als grote, meer zwaanachtige vogels. http://www.birdskorea.org/Birds/Miscellaneous/BK-BM-Eastern-Taiga-Bean-Goose.shtml (http://www.birdskorea.org/Birds/Miscellaneous/BK-BM-Eastern-Taiga-Bean-Goose.shtml)

Ik betrek de discussie even op de Alblasserwaard, waar ik regelmatig ganzen kijk. Het is een belangrijk overloopgebied van vooral brand- en kolganzen. Uit de ringmeldingen van de laatste soort blijkt wel hoeveel doorloop er de gehele winter nog in de ganzen is. Daardoor is elke groep brand- en kolganzen weer spannend. Verder duiken er altijd wel familiegroepjes kleine rietganzen en toendrarietganzen (max. 400) op tussen de max. 60.000 ganzen. De toendrarietganzen zijn vrij uitgesproken 'toendra's' en zorgen bij mij niet voor echte vraagtekens.

Er zijn vanaf 1998 nu drie zekere gevallen van taigarietgans die goed gedocumenteerd zijn. Het gaat om losse individuen, die zich aan de rand van de groep bewogen. Opvallen vind ik het solitaire optreden van deze klassiekers. De twee duidelijkste vogels (2005 en 2006) zijn najaarsgevallen. Even tussendoor: Finse taigarietganzen vetrekken half september naar Zuid-Zweden en de UK en zijn daar sneller dan de oostelijkere toendra's (Hearn 2004: 6-7). Er kunnen via die westelijke flyway natuurlijk altijd wat vogels doorschieten.

De Alblasserwaardse vogels:
http://www.nvwa.nl/taigarietgans_07-11-05.htm (http://www.nvwa.nl/taigarietgans_07-11-05.htm)
http://alblas.waarneming.nl/waarneming/view/1605480 (http://alblas.waarneming.nl/waarneming/view/1605480)
http://alblas.waarneming.nl/waarneming/view/41647153 (http://alblas.waarneming.nl/waarneming/view/41647153)

Deze drie waarnemingen passen aardig in het inmiddels ontstane beeld van het recente optreden van taigarietganzen in West-Nederland: vooral losse vogels of kleine groepjes die zich aansluiten bij andere ganzensoorten.
Titel: Re: rietgans, again...
Bericht door: theomuusse op februari 02, 2010, 23:02:01 pm
Kijk, dat noem ik ook echte taiga's.
Ofwel, het is echt niet zo moeilijk, ze springen er op jizz uit.

Theo
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op februari 02, 2010, 23:20:43 pm
Zou wel fijn zijn om waarnemingen van dit soort onomstreden beesten op de een of andere manier uit de enorme berg meuk te kunnen filteren  :( Dan kunnen we in afwachting van verder onderzoek in elk geval een beeld krijgen van het in NL voorkomen van nu al determineerbare taiga's.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 02, 2010, 23:42:50 pm
Ha Frank, misschien een domme vraag, maar ben je er zeker van dat dit rietganzen zijn? Zondag deed ik hetzelfde als jij en het viel me op dat veel 1e winter kolganzen op dit moment een prachtig lichte buik hebben (slijtage buikveren?).

Op mijn scherm lijken de snavels roze en in de uitsnede zie ik een zwarte snavelpunt. Toch kolgans?
Titel: Re: rietgans, again...
Bericht door: frankneijts op februari 02, 2010, 23:50:27 pm
Nee hoor Albert (geen domme vraag bedoel ik), ik zit me al enige uren het hoofd te breken of ik hier nu inderdaad het slachtoffer ben van een verkeerde interpretatie van kleuren. Ik had ook wat foto's van jonge Kollen waarbij het verschil tussen poot- en snavelkleur onmiddellijk in het oog sprong. Op deze foto niet + dat de vogels ook nog iets helderder leken (de meeste jonge Kollen hebben een soort van vage borstband). Maar al vóór ik je post las begon de twijfel meer en meer toe te slaan en nu denk ik dat je gewoon gelijk hebt. Die snavelpunt had ik voor 't gemak even genegeerd maar  dat klopt natuurlijk! Zo zie je maar weer...... (ik zal de post weghalen, slaat nou hier nergens op!)
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op februari 03, 2010, 08:15:23 am
Beste mensen,
 
Het afgelopen weekend het artikel 'Taxonomy of the bean goose-pink-footed goose' (M. Ruokonen, K. Litvin & T. Aarvak 2008, Molecular Phylogenetics and Evolution 48: 554-562) eens even rustig van A-Z doorgelezen, inclusief de bijlage.
 
Vooral de bijlage was erg nuttig om te lezen. Want wat blijkt:
 
* in totaal zijn er DNA monsters van 146 verschillende Rietganzen (dus excl. Kleine Rietgans) '... collected from breeding areas during ringing projects, from hunters or from museums.' [letterlijke tekst van artikel, pagina 556]. Ik kan hier niet anders uit concluderen dat dus alle 146 monsters betrekking hebben op (zekere) broedvogels en/of niet-vliegvlugge jongen. Kleine Rietgans laat ik hieronder buiten beschouwing.
 
Maar uit bijlage 1 (tabel S1, prachtig dat hij is opgenomen) valt te lezen:
1. van 5 vogels is geen datum bekend (dus geen dag, maand of jaar, laat staan een seizoen).
2. van 28 vogels is alleen het jaar bekend (dus geen dag en geen maand). Dit geldt bijvoorbeeld voor alle monsters van Kamchatka (11 middendorffii, 8 serrirostris, allemaal uit het jaar 2000).
3. alle 12 vogels (allemaal middendorffii) uit/van Khabarovsk ('Amur' in de hoofdtekst) zijn uit 'april 2000'. Dat is m.i. niet het broedseizoen.
4. 7 vogels uit Tomsk Oblast zijn verzameld op 3 of 4 mei 2002 (4 middendorffii, 3 fabalis) en een achtste vogel uit Tomsk Oblast (middendorffii) is verzameld in 'early May 1907'. Dat is m.i. ook niet in het broedseizoen.
5. er zijn diverse monsters van vogels laat in de zomer / herfst, bijvoorbeeld 24 augustus 1985, 29 september 1886, 14 september 1886, 10 september 1905. Is m.i. allemaal ver na het broedseizoen en heeft dus m.i. geen betrekking op broedvogels.
 
Later meer, maar de voorlopige conclusie van mij is wel dat het artikel slechts deels betrekking heeft op 'zekere broedvogels'.
 
Groetjes, Klaas

Pffff.. heremetijd , wat gaat dat allemaal snel. Weinig tot geen tijd om veel van die vragen te overdenken . Ik zie dit nu pas.
Een dingetje tussendoor. Het gaat de ondezoekers in eerste instantie niet om het fabalis complex te bekijken ( zie clade Fig.2) - daar gaat het ons nu juist wel om- , maar om , zie titel : Taxonomy of the bean goose-pink-footed goose.
Maar, veel vragen kan ik met je delen. Ik zou gewoon de moeite nemen om Ruokonen een mailtje te sturen met je vragen. Vrijwel alle onderzoekers staan hier open voor en zijn zelfs bijzonder gecharmeerd te constateren dat er in ieder geval nog ' buitenstaanders ' zijn die de moeite nemen  hun publicaties te lezen.
 
Wanneer we kijken naar Fig.1 , sampling localities , dan komen een aantal taxa er veel te bekaaid af. Het wachten is eigenlijk op een veel betere sampling in het gehele taiga en toendra gebied om een goed heuristic search te kunnen doen , want zoals ik al eerder opmerkte de consensus , zie Fig. 2 ziet er niet goed uit.

 
mvg
 
Herman van der Klis
 
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 03, 2010, 09:56:42 am
Kijk, dat noem ik ook echte taiga's.
Ofwel, het is echt niet zo moeilijk, ze springen er op jizz uit.

Theo


Dat is wel heel makkelijk geredeneerd. Zo kan ik ook een mooi wit adult mannetje witstuitbarmsijs laten zien en dan zeggen, zie je wel, een makkie om te herkennen, die witstuitbarmsijzen.
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 03, 2010, 09:59:21 am
Er er wordt wel wat gezegd over waar & wanneer diverse mogelijke 'splits' plaatsgevonden zouden kunnen hebben, maar concrete data / getallen worden niet echt duidelijk vermeld. Hoe meer is het lees, hoe vager het wordt.


Dat is dus precies omdat je daarvoor wél allerlei lastige aannames moet maken.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 03, 2010, 10:25:35 am
Vanwege gebrek aan tijd heb ik een poos dit topic niet in de gaten kunnen houden. Vanavond heb ik er even doorheen gelezen. Een voorbeeld van hoe een forum gebruikt zou moeten worden, chapeau! Leuk om te zien hoeveel artikelen langskomen die ik in de dikke map achter mij heb staan... hij wordt steeds dikker. Bedankt Lutzen, Klaas en Trinus voor het uitpluizen c.q. ontmantelen van Ruokonen e.a.(2008). Als alpha zijn zulke artikelen abacadabra, maar nu begint er toch iets te dagen. Hetzelfde onderzoek uitvoeren met een grotere sample size zou toch nog altijd beter zijn dan onderzoek in de wintergebieden, denk ik. Even wat reacties:
- Zoals al eerder aangegeven, zijn Sovons aantallen van taigarietgans te danken aan Leo van den Bergh en niet aan de mensen die nog meer in dat rijtje van 16 genoemd worden. Zijn artikelen vragen wat mij betreft toch echt om ondersteuning van ringmeldingen (100-en serrirostris in Oost-Drenthe, groepjes johansenii en een enkele middendorffi in het oosten. Prima, maar maakt het maar eens hard. Dat geldt overigens voor de hele problematiek).
- Theo, die Chinese vogels mag je niet op één hoop gooien. Het zijn voornamelijk plaatjes uit een overwinteringsgebied waar serrirostris en middendorffi gemixt worden. Er zitten zowel vogels met een uitgesproken lichte indruk, erg stevige hals en grote kop met diep gebogen en een stompe ondersnavel tussen als grote, meer zwaanachtige vogels. http://www.birdskorea.org/Birds/Miscellaneous/BK-BM-Eastern-Taiga-Bean-Goose.shtml (http://www.birdskorea.org/Birds/Miscellaneous/BK-BM-Eastern-Taiga-Bean-Goose.shtml)
hoi Albert,
Leuk om te lezen dat je profijt hebt van al die verschillende artikelen. Toch denk ik dat je ook als 'alfa' best wel -delen- van het artikel van Ruokonen ea. kunt lezen & begrijpen. Ik begrijp ook -nog- lang niet alles hoor: deels door gebrek aan inhoudelijke kennis van de finesses van de statistische bewerkingen, deels door gebrek aan kennis over de achterliggende methodiek van bv het opbouwen van figuur 2 (een 'consensus tree') en figuur 3 ('minimum spanning network') en deels door een tekort schietende kennis van -technisch- Engels.
 
Bijgaand even een ingescande pdf van de tekst over de Rietgans uit 'The Birds of Central Siberia' (Rogacheva 1992) wat m.i. een mooi beeld geeft van alle Russische kennis van dit immense gebied (ca. 2,4 miljoen vierkante kilometer). In de posting hierna een pdf met wat kaarten van 'Central Siberia' en een lijst met alle plaatsnamen met coördinaten. Beide pdf's heb ik 'dwars' ingescand. Na het openen van de pdf eerst even naar 'Beeld' gaan en de optie 'weergave roteren'.
 
Het kan best zo zijn dat al die aantallen Taigarietganzen berusten op waarnemingen van Leo van den Bergh. Dat staat niet / nauwelijks in de tekst van de wavo-rapporten te lezen. Maar dat doet er uiteindelijk allemaal niet zoveel toe. Het is juist de taak van samenstellers van dit soort wetenschappelijke rapporten (ergo dus van oa. Sovon) om het kaf van het koren te scheiden (dus onzin / onwaarschijnlijke waarnemingen / fouten eruit te gooien etc.). En hiervoor zijn alle 16 auteurs verantwoordelijk. Want hun naam staat erboven als auteur en dat houdt automatisch in dat je (a) verantwoordelijk bent voor de complete inhoud, (b) hier ook op kunt worden aangesproken cq jouw werkgever / instituut etc. Niet voor niets staan er een hele waslijst aan instituten etc. genoemd (en de waslijst wordt langer als je meerdere wavo-rapporten bekijkt). Sovon staat bekend / wil bekend staan als het instituut wat gedegen & betrouwbare informatie verzamelt over aantallen vogels en ontwikkelingen daarvan in Nederland.
 
Leuk dat je even een link geeft naar de situatie in Oost-Azië. Want daar heeft men misschien (deels?) met dezelfde problematiek te maken. Hoe onderscheid je middendorffii (cq taigabroeders) van serrirostris (cq toendrabroeders), of is het daar veel gemakkelijker (of juist nog veel ingewikkelder)?
 
En de enige oplossing van het probleem is inderdaad om een grotere steekproef te hebben van zekere broedvogels uit tal van verschillende gebieden uit Rusland. Maar dat zal niet gemakkelijk zijn. Zonder af te dingen op Russische onderzoekers (want er zijn een heel stel zeer goede mensen) vind ik het tekenend dat uit tabel S1 duidelijk naar voren komt dat van praktisch geen enkele recent geval (2000 enzo) uit Rusland (ook trouwens een hele rij uit Finland) -kennelijk- maten werden genomen.
 
Daarnaast zou je ook serieus na kunnen denken om op grote schaal te gaan werken met satellietzenders. Voordeel is namelijk dan dat je de vogels hier (in de wintergebieden) kunt vangen. Gewoon 50-100 vangen (Trinus weet precies hoe dat moet & wie je hiervoor kunt benaderen) en van een satellietzender voorzien en maar kijken / afwachten waar ze gaan broeden (en dus enkele jaren achtereen). En dat kun je dus -later- linken aan de maten, DNA analyses etc. Allemaal zaken die je hier onder -redelijke- standaardomstandigheden kunt vastleggen (dus snavelmaten, foto's etc. etc, etc.). Zal wat geld kosten (maar info verzamelen in Rusland is momenteel ook peperduur aan het worden), maar zal zeker veel opleveren.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 03, 2010, 10:26:35 am
en deel 2 met kaartjes en titelpagina.
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op februari 03, 2010, 11:02:38 am
Daarnaast zou je ook serieus na kunnen denken om op grote schaal te gaan werken met satellietzenders. Voordeel is namelijk dan dat je de vogels hier (in de wintergebieden) kunt vangen. Gewoon 50-100 vangen (Trinus weet precies hoe dat moet & wie je hiervoor kunt benaderen) en van een satellietzender voorzien en maar kijken / afwachten waar ze gaan broeden (en dus enkele jaren achtereen). En dat kun je dus -later- linken aan de maten, DNA analyses etc. Allemaal zaken die je hier onder -redelijke- standaardomstandigheden kunt vastleggen (dus snavelmaten, foto's etc. etc, etc.). Zal wat geld kosten (maar info verzamelen in Rusland is momenteel ook peperduur aan het worden), maar zal zeker veel opleveren.
 
Groetjes, Klaas

Hallo Klaas
 
Waarom toch sampelen in overwinterigsgebieden ?  Dan heb je achteraf veel te veel werk . Je kunt  beter meteen voor " the money" gaan .
Juist fabalis,rossicus,serrir. en  middend. in hun broedgebieden sampelen (DNA en morphologische kenmerken). De verstoring voor lief nemen , helaas. 
Je hebt het juiste taxon in zijn eigen habitat. Het is juist de interactie tussen de genetische aanpassing (bv.snavelgrootte en misschien lichaamsgrootte) en zijn broedgebied ( toendra- of taigagebieden/vegetatie) dat die beesten in de loop van de evolutie van elkaar deed onderscheiden en het gehele fabalis-complex  evolutie-biologisch gezien zo vreselijk interessant maakt.
Maar nogmaals dat is niet de eerste opzet geweest van de onderzoekers , het ging hen om de taxonomische positie van bean en pink-footed goose. Al het andere was blijkbaar op een gebrekkige en ongelukkige  manier " mooi meegenomen" .
 
mvg
 
Herman van der Klis
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 03, 2010, 11:26:42 am
Hallo Klaas, waarom toch sampelen in overwinterigsgebieden?  Dan heb je achteraf veel te veel werk. Je kunt beter meteen voor " the money" gaan. Juist fabalis, rossicus, serrir. en middend. in hun broedgebieden sampelen (DNA en morphologische kenmerken). De verstoring voor lief nemen, helaas. Je hebt het juiste taxon in zijn eigen habitat. Het is juist de interactie tussen de genetische aanpassing (bv.snavelgrootte en misschien lichaamsgrootte) en zijn broedgebied (toendra- of taigagebieden/vegetatie) dat die beesten in de loop van de evolutie van elkaar deed onderscheiden en het gehele fabalis-complex evolutie-biologisch gezien zo vreselijk interessant maakt. Maar nogmaals dat is niet de eerste opzet geweest van de onderzoekers, het ging hen om de taxonomische positie van bean en pink-footed goose. Al het andere was blijkbaar op een gebrekkige en ongelukkige  manier "mooi meegenomen". mvg Herman van der Klis
hoi Herman,
Tuurlijk, je hebt volkomen gelijk dat het vele malen beter is om monsters te verzamelen in de -veronderstelde- kernen van de broedgebieden van de verschillende populaties. Vroeger (voor 1989) onmogelijk als gezamenlijk internationaal project (en toen stond het genetisch onderzoek ook nog in de kinderschoenen), daarna een tijd relatief gemakkelijk, nu in toenemende mate (peper)duur. Vergeet niet dat flinke delen van Rusland niet / zeer moeizaam te bereiken zijn over de weg. Ik gaf gewoon een alternatief.
 
Volgens de laatste twee zinnen van de laatste alinea van de inleiding van Ruokonen was de opzet: 'We will examine whether the Bean Geese breeding in taiga and tundra habitats represent distinct species, or whether the observed morphological variation represents polymorphism within a species. A further aim is to clarify the taxonomic status of the Pink-footed Goose.' Dus primair meer inzicht krijgen in de situatie van Rietganzen, en pas secundair iets zeggen over de relatie met Kleine Rietgans.
 
Verder ben ik er ook achter waarom ik zo zat aan te hikken tegen het samenvoegen van de maten van man & vrouw in tabel 4, terwijl je weet dat Rietganzen een vrij duidelijke seksuele dimorfie hebben. Men heeft namelijk een ANOVA test gebruikt (zie rechterkolom op pagina 558 bovenaan) om vast te stellen of de verschillen tussen de taxa, zoals vermeld in tabel 4, significant waren of niet. Maar een ANOVA test mag je alleen maar gebruiken bij data die 'normaal' zijn verdeeld. En dat is hier niet het geval (bij een veel grotere steekproef waarbij je man & vrouw lumpt zul je namelijk een tweetoppig patroon krijgen) en dan mag je geen ANOVA gebruiken (want die toetst op data die normaal zijn verdeeld).
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op februari 03, 2010, 13:14:51 pm
Verder ben ik er ook achter waarom ik zo zat aan te hikken tegen het samenvoegen van de maten van man & vrouw in tabel 4, terwijl je weet dat Rietganzen een vrij duidelijke seksuele dimorfie hebben. Men heeft namelijk een ANOVA test gebruikt (zie rechterkolom op pagina 558 bovenaan) om vast te stellen of de verschillen tussen de taxa, zoals vermeld in tabel 4, significant waren of niet. Maar een ANOVA test mag je alleen maar gebruiken bij data die 'normaal' zijn verdeeld. En dat is hier niet het geval (bij een veel grotere steekproef waarbij je man & vrouw lumpt zul je namelijk een tweetoppig patroon krijgen) en dan mag je geen ANOVA gebruiken (want die toetst op data die normaal zijn verdeeld).
 
Groetjes, Klaas


Hoi Klaas,
 
De spreiding van snavelgrootte bij mannetjes en vrouwtjes kunnen (toch ?) normaal zijn , dat kan ik helaas niet uit  het artikel halen. Zo ja , dan zal ie toch zeker wel een two-way- anova hebben gebruikt ? Lijkt mij wel.
 
Maar ben erg nieuwschierig of er een vervolg onderzoek komt.
 
Duur ?  Wel nee , slechts een standaard ingericht moleculair labje :  een paar waterbaden , pipetten , wat goedkope chemicalien (Tris,EDTA, CTAB , Chloroform , Isopropanol. en Ethanol maakt zuiver DNA en dan nog wat markers , PCR-apparaat, gel-electroforese bak ,pc met SPSS (ANOVA) en PAUP (om bomen te maken). Tenslotte een goedkope student . En draaien die handel.
 
Wat naar verhouding veel duurder is , is de reis , hotelkosten etc. etc.
 
mvg
 
Herman van der Klis
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 03, 2010, 13:20:59 pm
Duur ?  Wel nee , slechts een standaard ingericht moleculair labje :  een paar waterbaden , pipetten , wat goedkope chemicalien (Tris,EDTA, CTAB , Chloroform , Isopropanol. en Ethanol maakt zuiver DNA en dan nog wat markers , PCR-apparaat, gel-electroforese bak ,pc met SPSS (ANOVA) en PAUP (om bomen te maken). Tenslotte een goedkope student . En draaien die handel.
 
Wat naar verhouding veel duurder is , is de reis , hotelkosten etc. etc.
Volgens mij vergeet je het belangrijkste nog, namelijk het vangen van de vogels.
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op februari 03, 2010, 13:26:30 pm
Duur ?  Wel nee , slechts een standaard ingericht moleculair labje :  een paar waterbaden , pipetten , wat goedkope chemicalien (Tris,EDTA, CTAB , Chloroform , Isopropanol. en Ethanol maakt zuiver DNA en dan nog wat markers , PCR-apparaat, gel-electroforese bak ,pc met SPSS (ANOVA) en PAUP (om bomen te maken). Tenslotte een goedkope student . En draaien die handel.
 
Wat naar verhouding veel duurder is , is de reis , hotelkosten etc. etc.
Volgens mij vergeet je het belangrijkste nog, namelijk het vangen van de vogels.

Da's iets lastiger . Ik had vroeger alleen maar een rotte banaan nodig in een jampotje om Drosophila's te vangen voor soortgelijk onderzoek.
 
mvg
 
Herman van der Klis
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 03, 2010, 15:08:06 pm
Een mooie vogel van gisteren; http://waarneming.nl/fotonew/9/1045969.jpg (http://waarneming.nl/fotonew/9/1045969.jpg)
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 03, 2010, 19:11:54 pm
Het artikel van Ruokonen is de afgelopen dagen flink onder de loep genomen. Veel van wat in het artikel van Ruokonen aan de orde komt heeft betrekking op alle soorten en ondersoorten "rietganzen" in het gehele Euroaziatische gebied. Als we naar het westelijke deel van het hele gebied kijken dan worden daar door Ruokonen 2 ondersoorten gedefinieerd, namelijk Anser fabalis fabalis en Anser fabalis rossicus. Of dit nou soorten of ondersoorten zijn, dat moet maar worden uitgevochten door taxonomen en DNA-specialisten. Ooit zal daar wel een eensluidend antwoord op komen, uiteraard op basis van state-of-the-art technologieën. Tot die tijd moeten we ons "behelpen" met andere publikaties.
 
Veel van wat in Nederland is geschreven over "rietganzen" komt van de hand van Leo van den Bergh, vermoedelijk inclusief de soortteksten in de recentelijk verschenen SOVON-rapporten (dus inclusief de tegenstrijdige informatie in die laatste rapporten). De vraag is m.i. gerechtvaardigd in hoeverre alles wat door hem geschreven is als betrouwbare informatie beschouwd moet worden (kom hier later nog op terug).
 
 
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 03, 2010, 19:28:56 pm
Een mooie vogel van gisteren; http://waarneming.nl/fotonew/9/1045969.jpg (http://waarneming.nl/fotonew/9/1045969.jpg) 
Justin, bedankt hiervoor. 100% zeker een Taigarietgans? Dezelfde foto staat nu ook op de site van DB, http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=1&fid=2200&page=1 (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=1&fid=2200&page=1) Gemaakt op 2 februari 2010 (=gister) door Edwin de Weerd in / bij het Westerse Veld in Drenthe. Waar blijven andere foto's?
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 03, 2010, 20:06:18 pm
Ik denk niet Klaas, d'r zitten er gewoonweg niet veel. Mijn beste, maar of het er eentje is, staat ook niet vast (zie eerdere commentaren) is onderstaande vogel, ondanks (of juist door) geploeter door vele 1000-en rietganzen.
(http://waarneming.nl/fotonew/5/1040535.jpg)
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op februari 03, 2010, 21:41:58 pm
Hier wat plaatjes van vandaag tussen Smilde en Oranje (Drenthe)
 
Edwin.
Titel: Re: rietgans, again...
Bericht door: theomuusse op februari 03, 2010, 22:31:53 pm
Kijk, dat noem ik ook echte taiga's.
Ofwel, het is echt niet zo moeilijk, ze springen er op jizz uit.

Theo


Dat is wel heel makkelijk geredeneerd. Zo kan ik ook een mooi wit adult mannetje witstuitbarmsijs laten zien en dan zeggen, zie je wel, een makkie om te herkennen, die witstuitbarmsijzen.

De makkelijke vogels zijn misschien niet de makkelijkste, bovendien leer je veel over jizz ed.
Ga jij ook gelijk naar 1e winter heuglins meeuwen zoeken als je net bent begonnen met meeuwen?
Door de duidelijke (misschien makkelijk, misschien zijn ze allemaal zo) goed te bekijken, kun je verder en eventueel nieuwe dingen zien, in ieder geval kun je dan er goed naar kijken.

Theo
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 03, 2010, 23:49:40 pm
Hier wat plaatjes van vandaag tussen Smilde en Oranje (Drenthe) Edwin.
hoi Edwin, hartstikke bedankt hiervoor.
 
Nog even een scan gemaakt van een (stok?)oud artikel: Kees Roselaar (1977). De geografische variantie van de Rietgans. Watervogels 2: 61-68. Blijkt te staan in een themanummer van 'Watervogels' over Rietganzen. Uit mei 1977 toen deel 1 van de Cramp nog niet eens was verschenen (Kees is hier bij de Rietgans ook auteur van het stukje 'Geographical variation'). Helaas komen twee figuren niet helemaal goed over op de scan (ik kan eventueel nog wel een kleurenscan hiervan maken). Interessant vond ik Kees zijn opmerking over ruitrek van Taigarietganzen naar Nova Zembla (= dik in de toendra) en dat de Russissche auteur Dementiev hier geen rekening mee had gehouden.
 
 
(...) want zoals ik al eerder opmerkte de consensus, zie Fig. 2 ziet er niet goed uit. mvg Herman van der Klis
hoi Herman, zou je eens kunnen uitleggen wat hier mis aan is. Want het zegt mij allemaal niet zoveel. Dus wat lees jij allemaal wel en niet in dit 'consensus diagram', wat moet ik aan met de opmerking 'branches with less than 50% support were collapsed' (weggegooid / verwijderd etc?), een kreetje als 'parsimony-informative' etc. Ik zie nu trouwens ook dat in de laatste regel van het onderschrift van figuur 2 de verklaring staat van (bv) ROS2a en ROS2b (begreep ik een aantal dagen gelden nog niet, maar zo leer ik steeds meer).
 
 
Verder ben ik er ook achter waarom ik zo zat aan te hikken tegen het samenvoegen van de maten van man & vrouw in tabel 4, terwijl je weet dat Rietganzen een vrij duidelijke seksuele dimorfie hebben. Men heeft namelijk een ANOVA test gebruikt (zie rechterkolom op pagina 558 bovenaan) om vast te stellen of de verschillen tussen de taxa, zoals vermeld in tabel 4, significant waren of niet. Maar een ANOVA test mag je alleen maar gebruiken bij data die 'normaal' zijn verdeeld. En dat is hier niet het geval (bij een veel grotere steekproef waarbij je man & vrouw lumpt zul je namelijk een tweetoppig patroon krijgen) en dan mag je geen ANOVA gebruiken (want die toetst op data die normaal zijn verdeeld). Groetjes, Klaas
 

Hoi Klaas, De spreiding van snavelgrootte bij mannetjes en vrouwtjes kunnen (toch ?) normaal zijn, dat kan ik helaas niet uit  het artikel halen. Zo ja, dan zal ie toch zeker wel een two-way- anova hebben gebruikt? Lijkt mij wel. mvg Herman van der Klis
hoi Herman, ik kan zo direct geen reden bedenken waarom snavellengte (en tarsuslengte, koplengte, snaveldikte etc etc etc) niet normaal verdeeld zijn. Want dat is m.i. bij (bijna) al dit soort maten bij vogels altijd juist wel het geval. Je kunt dus ook prima anova etc, gebruiken bij het vergelijken van bv. man <--> vrouw van hetzelfde taxon, man taxon 1 <---> man taxon 2, vrouw taxon 1 <---> vrouw taxon 2 <---> vrouw taxon 3 etc. Dat mag allemaal wel (maar liefst wel met een beetje fatsoenlijke N).
Maar je weet (zie bv Cramp) dat man groter is dan vrouw. Wat Ruokonen c.s. m.i. hebben gedaan is anova toepassen op (man + vrouw) taxon 1 <---> (man + vrouw) taxon 2 <----> (man + vrouw) taxon 3 (etc.). En dan mag je niet anova gebruiken, omdat je (a) weet dat man & vrouw geen gelijke maten hebben (bij Goudplevier bv wel). Maak maar eens een histogram van de snavelhoogte van 100 man rietgans taxon a en een tweede histogram van 100 vrouw rietgans taxon a. Dan heb je dus vast wel twee mooie klokvormige diagrammen. Maar als je beide datasets in elkaar schuift, krijg je een histogram met N = 200 en met of een tweetoppig verloop, of met een breed middenstuk (o.i.d.). Daarbij staat ook nog eens niets aangegevens de verhouding man / vrouw van de monsters. Wie weet schieten jagers wel selectief juist mannen (of juist vrouwen). Who knows?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Weia op februari 04, 2010, 10:22:29 am
hoi Herman, ik kan zo direct geen reden bedenken waarom snavellengte (en tarsuslengte, koplengte, snaveldikte etc etc etc) niet normaal verdeeld zijn.
Wanneer mannetjes en vrouwtjes een ander postuur hebben zijn het twee normaalverdelingen, die mag je nooit in 1 statistische toets samenvoegen. Dat is denk ik bedoeld.
Titel: Re: rietgans, again...
Bericht door: Herman van der Klis op februari 04, 2010, 13:20:39 pm
(...) want zoals ik al eerder opmerkte de consensus, zie Fig. 2 ziet er niet goed uit. mvg Herman van der Klis
hoi Herman, zou je eens kunnen uitleggen wat hier mis aan is. Want het zegt mij allemaal niet zoveel. Dus wat lees jij allemaal wel en niet in dit 'consensus diagram', wat moet ik aan met de opmerking 'branches with less than 50% .......
 

Verder ben ik er ook achter waarom ik zo zat aan te hikken tegen het samenvoegen van de maten van man & vrouw in tabel 4, terwijl je weet dat Rietganzen een vrij duidelijke seksuele dimorfie hebben. Men heeft namelijk een ANOVA test gebruikt (zie rechterkolom op pagina 558 bovenaan) om vast te stellen of de verschillen tussen de taxa, zoals vermeld in tabel 4, significant waren of niet. Maar een ANOVA test mag je alleen maar gebruiken bij data die 'normaal' zijn verdeeld. En dat is hier niet het geval (bij een veel grotere steekproef waarbij je man & vrouw lumpt zul je namelijk een tweetoppig patroon krijgen) en dan mag je geen ANOVA gebruiken (want die toetst op data die normaal zijn verdeeld). Groetjes, Klaas
 

Hoi Klaas, De spreiding van snavelgrootte bij mannetjes en vrouwtjes kunnen (toch ?) normaal zijn, dat kan ik helaas niet uit  het artikel halen. Zo ja, dan zal ie toch zeker wel een two-way- anova hebben gebruikt? Lijkt mij wel. mvg Herman van der Klis
hoi Herman, ik kan zo direct geen reden bedenken waarom snavellengte (en tarsuslengte, koplengte, snaveldikte etc etc etc) niet normaal verdeeld zijn. Want dat is m.i. bij (bijna) al dit soort maten bij vogels altijd juist wel het geval. Je kunt dus ook prima anova etc, gebruiken bij het vergelijken van bv. man <--> vrouw van hetzelfde taxon, man taxon 1 <---> man taxon 2, vrouw taxon 1 <---> vrouw taxon 2 <---> vrouw taxon 3 etc. Dat mag allemaal wel (maar liefst wel met een beetje fatsoenlijke N).
Maar je weet (zie bv Cramp) dat man groter is dan vrouw. Wat Ruokonen c.s. m.i. hebben gedaan is anova toepassen op (man + vrouw) taxon 1 <---> (man + vrouw) taxon 2 <----> (man + vrouw) taxon 3 (etc.). En dan mag je niet anova gebruiken, omdat je (a) weet dat man & vrouw geen gelijke maten hebben (bij Goudplevier bv wel). Maak maar eens een histogram van de snavelhoogte van 100 man rietgans taxon a en een tweede histogram van 100 vrouw rietgans taxon a. Dan heb je dus vast wel twee mooie klokvormige diagrammen. Maar als je beide datasets in elkaar schuift, krijg je een histogram met N = 200 en met of een tweetoppig verloop, of met een breed middenstuk (o.i.d.). Daarbij staat ook nog eens niets aangegevens de verhouding man / vrouw van de monsters. Wie weet schieten jagers wel selectief juist mannen (of juist vrouwen). Who knows?
 
Groetjes, Klaas

Hoi Klaas , om de eerste vraag te beantwoorden. De consensus Fig.2 tree ziet er v.w.b. de Bra en de Mid wel goed uit. Hij is wat we noemen goed opgelost. Het gehele Fab-complex niet . Hoe zie je dat ? Kijk naar de bootstrap values , dit zijn de getalletjes die je boven de vertakkingen (branches) ziet staan. Deze getallen willen we het liefst dicht bij 100 zien , dit gaat wel op bij Bra en Mid , zij zitten immers ook in een mooie clade.
Niet dus bij de alle taiga (onder)soorten. Waarden als 58 en 54 zijn zwaar onvoldoende.
Wat zijn dat voor getallen en hoe komen we er aan ?
Ik heb hier even een fictief matrixje met DNA-samples.
 
fabalis         AGTATTATATACCCGTATACATAAGACATACTATGTATATCGTGCATTAA
rissicus        AGTATTATATACCCGTATACATAAGACATACTATGTATGTCGTGCATTAA
serrirostris    GGTATTATACACCCATATACATAAGACATACTATGTATATCGTGCATTAA
rossicus       GGTATTATACACCCATGTACATAAGACATACTATGTATATCGTGCATTAA
middendorffii TGTATTATAGACCCCTGTACATAAGACATACTATGTATGTCGTGCATTAA
bra             CGTATTATAGACCCCTGTACATAAGACATACTATGTATGTCGTGCATTAA   
 
DNA geisoleerd , gesequenced (= basevolgorde bepalen) en vervolgens de overeenkomstige stukken stukjes DNA keurig netjes onder elkaar gezet in een matrix. Nu laat je de computer (PAUP = speciaal programme hier voor )vervolgens een parsimony tree uitrekenen. Let wel ; dit is maar een zeer klein stukje DNA ,in de praktijk werk je natuurlijk met veeeeel grotere stukken.En dan maar hopen dat uit het geheel een mooie concensus boom te voorschijn komt. Wanneer uit iedere rekensessie ( je kunt dit bv. instellen op 1000 keer uitrekenen) dezelfde verdeling uitkomt , zal dat een bootstrap van 100(%)opleveren. In een ander geval bv Ros. 54 , dus in 46% gevallen iets anders.En dat is veel.Hoe komt dit ? Tijdens het rekenen (vergelijken) komen er iedere keer conflictsituaties tegen. Zeg maar data , die eerst wel en later weer niet met elkaar "rijmen".
Algemeen wordt een waarde van pakweg 70 a 75 als minimale bootstrapwaarde beschouwd.
Met veel minder kun je als onderzoeker nooit tevreden zijn.
 
De tweede vraag is wat lastiger , omdat ik ook niet weet wat Ruokonen precies gedaan heeft. Wel weet ik , maar dan moet ik ook even dingen uit mijn herinneringen terughalen . Wanneer de overlap groot genoeg is tussen mannetjes en vrouwtjes zul je deze waarden volgens mij zeker bij elkaar kunnen voegen in een ANOVA test.
Toch even een klein gewetensvraagje tussendoor.Ik hoop dat je niet in de war bent met N en F. De N in tabel 4 zijn  het aantal individuen , terwijl ANOVA testen niet worden aangeduid met N maar met F-waarden.
Ik kan me wel voorstellen dat het onderscheid tussen mannetjes en vrouwtjes bij de verschillende (onder)soorten in het fabalis-complex vaak erg onduidelijk is , en dus alleen al om die reden bij elkaar gevoegd zijn. Maar ik ben het in de kern met je eens , mannetjes en vrouwtjes apart meten is natuurlijk  netter .
 
mvg
 
Herman van dere Klis
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 04, 2010, 14:42:38 pm
Veel van wat in Nederland is geschreven over "rietganzen" komt van de hand van Leo van den Bergh, vermoedelijk inclusief de soortteksten in de recentelijk verschenen SOVON-rapporten (dus inclusief de tegenstrijdige informatie in die laatste rapporten). De vraag is m.i. gerechtvaardigd in hoeverre alles wat door hem geschreven is als betrouwbare informatie beschouwd moet worden (kom hier later nog op terug).
Ik heb de artikelen uit 2003 en 2004 van Leo van den Bergh over het voorkomen van Rietganzen rond Nijmegen en in Drenthe nog eens doorgenomen. In de artikelen worden de verschillende soorten en ondersoorten op in mijn ogen nogal chaotische wijze aangeduidt. Ik heb alle benamingen die in de artikelen zijn gebruikt nog eens op een rijtje gezet (zie bijlage). Zoals te lezen worden voor bijvoorbeeld Anser fabalis fabalis maar liefst minimaal 14 verschillende aanduidingen gebruikt.
 
Een aantal zaken die verder opvallen. Over alle (onder)soorten wordt met een bepaalde vanzelfsprekendheid geschreven. Anser fabalis johanseni en Anser serrirostris serrirostris worden in groepen van respectievelijk vele honderden of zelfs duizenden waargenomen alsof dat allemaal heel normaal zou zijn. Tevens worden herhaaldelijk kleine (familie)groepjes Anser (fabalis) middendorffi gezien. Ook wordt in het artikel over Drenthe bijna terloops en kritiekloos opgemerkt dat door een waarnemer 7625 Anser serrirostris serrirostris rond het Fochteloerveen werden waargenomen. Dit terwijl de populatie die in Oost-Azie broedt op slechts circa 55.000 vogels wordt geschat (schattingen lopen uiteen van 45.000 tot 65.000). De 1% norm voor deze ondersoort is 550 vogels. Dat zou dus betekenen dat het Fochteloerveen van internationale betekenis is voor deze bedreigde Oost-Aziatische ondersoort! De norm wordt zelfs 13 keer overschreden!
 
Het verhaal dat er meer vogels van oostelijke herkomst naar Nederland komen doordat de vogels die vroeger in het Pannonische gebied (zeg maar Hongarije en omgeving) overwinterden en dat nu in Nederland doen suggereert dat in het Pannonische gebied traditioneel "rietganzen" van oostelijke herkomst zouden overwinteren. Volgens mij is dat nog nooit vastgesteld. Ook dat leap-frog verhaal klinkt heel interessant, maar er is m.i. geen enkele aanwijzing voor.
 
Voorzover mij bekend is er buiten Leo van den Bergh niemand die ooit heeft gepubliceerd over het voorkomen van "oostelijke rietganzen" in Europa, zeker niet in de aantallen die hij zegt te zijn tegengekomen bij zijn veldwerk. Het enige bewijs voor deze "oostelijke rietganzen" zijn de waarnemingen van Leo van den Bergh. Dat is natuurlijk nogal mager bewijs.
 
Als het echt zo zou zijn dat "rietganzen"" van zo oostelijk in Nederland zouden kunnen worden aangetroffen dan zou dat m.i. tamelijk sensationeel zijn en zou een artikel in een serieus ornithologisch tijdschrift wel op z'n plaats zijn. Zeker gezien de dramatisch lage en afnemende aantallen van alle soorten "rietganzen" in Oost-Azie (zie: http://ornitology.krasu.ru/files/goos.pdf (http://ornitology.krasu.ru/files/goos.pdf))
 
Totdat het tegendeel bewezen is lijkt het mij verstandig om uit te blijven gaan van het voorkomen in Nederland van slechts 2 soorten of ondersoorten "rietganzen", namelijk de Taigarietgans Anser (fabalis) fabalis en Toendrarietgans Anser serrirrostris rossicus (of Anser fabalis rossicus). En in de praktijk dus tegenwoordig alleen nog maar de Toendrarietgans Anser serrirostris rossicus. Kan het nog overzichtelijker?
 
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 04, 2010, 14:57:42 pm
Onlangs verscheen in het Deense tijdschrift "Fugle i felten" een determinatieartikel over hoe men Toendrarietganzen kon onderscheiden van Taigarietganzen, dus een situatie net andersom dan in Nederland. Hier is het te lezen: http://www.dof.dk/sider/images/stories/publikationer/fif/dokumenter/Tundrasaedgaes_FIF_01_10.pdf (http://www.dof.dk/sider/images/stories/publikationer/fif/dokumenter/Tundrasaedgaes_FIF_01_10.pdf)
Met een beetje fantasie is het deenstalige artikel redelijk te lezen en anders maar even door Google laten vertalen.
 
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op februari 05, 2010, 06:57:56 am
Ik heb de artikelen uit 2003 en 2004 van Leo van den Bergh over het voorkomen van Rietganzen rond Nijmegen en in Drenthe nog eens doorgenomen. In de artikelen worden de verschillende soorten en ondersoorten op chaotische wijze aangeduidt. Ik heb alle benamingen die in de artikelen zijn gebruikt nog eens op een rijtje gezet (zie bijlage). Zoals te lezen worden voor bijvoorbeeld Anser fabalis fabalis maar liefst minimaal 14 verschillende aanduidingen gebruikt.
 
(...)
 
Totdat het tegendeel bewezen is lijkt het mij verstandig om uit te blijven gaan van het voorkomen in Nederland van slechts 2 soorten of ondersoorten "rietganzen", namelijk de Taigarietgans Anser (fabalis) fabalis en Toendrarietgans Anser serrirrostris rossicus (of Anser fabalis rossicus). En in de praktijk dus tegenwoordig alleen nog maar de Toendrarietgans Anser serrirostris rossicus. Kan het nog overzichtelijker?

Trinus,
 
Je mag Van den Berghs aanduidingen chaotisch noemen, maar het komt in feite natuurlijk gewoon neer op vijf taxa en een kleurafwijking (waarvan bij Toendra de twee ondersoortnamen de lading niet dekken, maar de intermediaire vogels 'zware rossicus' genoemd worden en de vogels van ZO-Taimyr 'curtus'). Met die chaos valt het m.i. dus nog wel mee, afgezien natuurlijk van de vraag hoe waarschijnlijk dit regelmatige voorkomen van oostelijke beesten is.
 
Je laatste alinea lijkt inderdaad een heel overzichtelijk beeld te schetsen, maar ik sluit niet uit dat je hiermee onvoldoende recht doet aan de grote morfologische verschillen tussen in Nederland opduikende groepen 'Toendrarietganzen'. Lützen heeft terecht al verschillende keren aandacht gevraagd voor dit fenomeen. Niet om een makkelijk probleem persé moeilijk te willen maken, maar op basis van mijn veldervaringen krijg ik het er ook steeds moeilijker mee om de vele (veel meer dan vijf!) verschillende hier voorkomende types/populaties (of hoe je ze ook wilt noemen), allemaal maar over één kam te scheren. Overigens geeft Palmer, aangehaald in Roselaar (1977), een buitengewoon interessante theorie om dit verschijnsel te verklaren: "Palmer (...) voert ook een andere reden aan om de westelijke populaties niet verder in te delen. Volgens hem komen de verschillen tussen de ene groep rietganzen en de andere tot stand door de grote plaatstrouw aan zowel broed- als wintergebied en grote binding tussen de diverse individuen van een groep, gevolgd door inteelt. Vormt zich binnen een bepaalde locale populatie door toeval een bepaald kenmerk, bijvoorbeeld een dikke snavel, dan blijft dat kenmerk zeer lang binnen die groep gehandhaafd zonder veel invloed uit te oefenen op de snavelvorm van naburige populaties. Allerlei morfologische kenmerken variëren onafhankelijk van elkaar en komen in verschillende combinaties bij allerlei populaties voor, onafhankelijk van een taiga- of toendra-habitat."
 
Tenslotte zou ik je willen vragen hoe je nu aankijkt tegen de zwartbekken op de eerder door mij aangehaalde foto's van resp. Bob Woets en Lützen Portengen. Zulke beesten zijn in Nederland zonder enige twijfel superzeldzaam. Zelf kwam ik onlangs voor het eerst (na vele duizenden rietganzen!) een zestal van dit soort kolossen tegen: met recht Kleine Zwanen in rietganskostuum! Ik noem zulke beesten zonder gęne Taiga's, maar zijn er aanwijzingen voor het bestaan van zwartsnavelige populaties fabalis ten westen van de Oeral (of, ik durf het bijna niet te zeggen, moeten we dan toch echt aan 'johanseni' gaan denken)?
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 05, 2010, 08:09:30 am
Hier nog zo'n gezellige vogel van gisteren. Nog steeds niet de lekkere Taiga welke ik nou echt verwacht. Tis een reus, maar is het nou een echt volgevreten Toendra of toch een Taiga?
(http://waarneming.nl/fotonew/2/1047792.jpg)
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op februari 05, 2010, 08:23:16 am
Phoe JJ zoals ik al stelde...zou een zwartbek kunnen zijn, wel erg groot.
 
Even een vraag aan de anderen. Kunnen we nu stellen dat "geelbek Taiga's" de meest westelijk voorkomende Taiga's zijn en dus in NL het meest te verwachten. Zwartbek Taiga's komen dus van oostelijker (ik dacht al achter de Oeral dus da's niet zo heel ver) en zijn dus minder te verwachten dan de geelbekken. klopt dieze veronderstelling volgens jullie nu nog (mogelijk overheen gelezen, sorry dan). Valt mij in ieder geval op dat de meeste overtuigende gefotografeerde Taiga's nagenoeg allemaal "geelbekken" zijn. Van de Oeral naar NL is een peulenschil voor ganzen en dus zouden "zwartbekken" hier toch makkelijk moeten kunnen zitten alleen we vinden ze niet (behalve Leo), of mijn theorie klopt niet. Ik dacht dat zwartbek synonienm was voor Johansenii. Indien zo en indien Johansenii nog steeds een valide ondersoort is (ergens gelezen dat dit betwijfeld wordt) hebben we drie taxa rietganzen in NL, rossicus, fabalis johansenii (de laatste zou dan de meest schaarse zijn of de minst herkent)
 
Als laatste wordt volgens mij het geelbek en zwartbek verhaal nog vertroebeld doordat er ook zwartbekken in Scandinavie zitten en mogelijk ook geelbekken achter de Oeral, toch????
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op februari 05, 2010, 09:04:10 am
Ik heb zo goed en zo kwaad als het ging silletjes getrokken van een van mijn waarneming uit 2002: http://waarneming.nl/user/view/10891?sp=338&prov=0&from=1985-02-05&to=2010-02-05 (http://waarneming.nl/user/view/10891?sp=338&prov=0&from=1985-02-05&to=2010-02-05). Met wat goed wil is te zien dat alle vogels oranje snavels hebben en op een van de middelste stills is met nog meer goede wil de structuur van de vogel als Taiga te zien.
 
Marc Plomp heeft beloofd zijn beelden uit Flevoland 200? online te zetten die hij gebruikt voor de DVD "Onze ganzen". Zo documenteren we zo veel mogelijk uit het verleden.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 05, 2010, 09:32:52 am
Intressant blijft dat hele volksstammen nog steeds Taigarietganzen blijven invoeren zie o.a. http://waarneming.nl/soort/view/338 (http://waarneming.nl/soort/view/338) . De enkele foto die bijgevoegd is geeft meestal Toendrarietgans of een erg daarop lijkende vogel op. Blijkbaar volgen dus weinig mensen deze discussie gezien het aantal beesten wat dus structureel wordt ingevoerd.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 05, 2010, 10:51:59 am
Ik heb eigenlijk niet heel veel toe te voegen aan hetgeen PieterGeert heeft gezegd, maar wil nog wel even kwijt dat ik niet teveel waarde zou hechten aan allerhand determinatie-artikelen zoals dat stukje in "Fugle i felten".De foto’s in dat artikel komen allemaal van Netfugl en het grote probleem is dat de determinatie van die vogels ook maar een slag in de lucht is. Staan er op die foto met 2 vliegende rietganzen nu echt een Taiga en Toendra, of zouden het misschien toch gewoon 2 Taigas zijn?

Gegeven de tekst bij de waarneming (5 vogels, waarvan 2 Toendras) ga ik voor het laatste:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=13855

Vind de beperkte discussie op Netfugl zelf interessanter:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=5506
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=5505
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=1418
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=1417
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=1416
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=1415
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=8794
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=8793


En laten we wel zijn, er zijn niet veel mensen in Nederland die van veel van deze vogels Taiga’s zouden maken, en dat zal niet beter worden als we weer allemaal alleen op zoek gaan naar dit soort vogels:
http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=2200&page=zoek
Wat voor dier loopt er bijv. achter die vogel?

Zweedse vogels waar eerder naar gelinkt werd zijn echt fabalis hoor, Theo (ik zie hierboven tenminste vergelijkbare dieren):
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31699

Misschien leuk om nog even op de website van de fotograaf zelf rond te neuzen:
http://www2.birdphotos.dk/birds/saedgaas.htm
http://www2.birdphotos.dk/birds/saedgaas,%20tundra.htm

Foto waar ik eerder commentaar over vroeg:
http://www.artportalen.se/artportalen/gallery/Image.aspx?rappsyst=0&obsID=17651876&imageID=186275

Volgens de tekst maakt Arnoud van den Berg er een Toendra van vanwege vorm en lengte van de nek en snavelvorm. Nu heeft ie zich wellicht een stuk genuanceerder uitgedrukt (zie zelf ook wel eens uitspraken van mezelf terug waarin ik me nauwelijks kan herkennen), maar belangrijker is toch dat er met deze vogel niets mis is voor een Taiga (en dat is daar toch nog de default). Wat dat betreft ben ik niet snel meer onder de indruk van veronderstelde expertise van anderen op dit gebied. Aan de andere kant zie ik het best het reeele gevaar dat ik me dood zit te staren op variatie binnen Toendrarietgans (toch een beetje geschrokken van die vogels in het Vlijmens Ven  ;)), dus laten we vooral nog even doorgaan met deze discussie.

Overigens vind ik het verschil in neklengte tussen foto’s (populaties?) opvallend. Zal deels te maken hebben met activiteit (en geeft aan hoe gevaarlijk blindvaren op“jizz” kan zijn), maar dan nog.

@Max:Vogels van jou doen mij eerder denken aan wat ik (o.a.) eerder dit jaar in Oss zag (zeg maar het grofsnavelige type), interessant, kom ik nog op terug!

Videovan MarcPlomp was eerder te zien op Birdforum TV (members only geloof ik):
http://www.birdforum.tv/members/action/viewvideo/440/Taiga_Bean_Goose/
Het lukt me nu echter niet meer die te zien te krijgen, vermoedelijk omdat ik op mijn werk zit  :angel:

Later wellicht meer, ik probeer zeker input te leveren, maar druk, druk,druk…


Lützen
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 05, 2010, 14:37:07 pm
Misschien leuk om nog even op de website van de fotograaf zelf rond te neuzen: http://www2.birdphotos.dk/birds/saedgaas.htm (http://www2.birdphotos.dk/birds/saedgaas.htm)
http://www2.birdphotos.dk/birds/saedgaas,%20tundra.htm (http://www2.birdphotos.dk/birds/saedgaas,%20tundra.htm) (...). Wat dat betreft ben ik niet snel meer onder de indruk van veronderstelde expertise van anderen op dit gebied. Aan de andere kant zie ik het best het reeele gevaar dat ik me dood zit te staren op variatie binnen Toendrarietgans (toch een beetje geschrokken van die vogels in het Vlijmens Ven), dus laten we vooral nog even doorgaan met deze discussie. Lützen
hoi Lützen,
Erg leuk om even deze beide links te geven. Bij de ene link viel me op dat hij het heeft over 'Forest Bean Goose' (Anser fabalis fabalis - Skov Saedgas).
Bij de andere link vroeg ik me af hoe 'wild' dit individu is. Prachtige detailfoto's van een (veronderstelde?) Toendrarietgans, maar wel genomen in 'Copenhagen March'. Toevallig ben ik meerdere jaren in maart in Kopenhagen geweest. We keken vooral naar geringde meeuwen, maar ik ken daardoor de stadsparken etc. wel goed. Net geen overzichtsfoto zodat je de locatie goed kunt inschatten, maar het zou me niets verbazen als deze foto's ergens bij / rond Utterslev Mose zijn genomen. Daar heb je enorm veel Grauwe Ganzen en van die mooie grazige grasvelden vol met ganzenmest. Ook erg goed voor Kokmeeuwen etc.
 
Wat mij betreft is de discussie ook nog lang niet gesloten. Want ik begrijp er nog steeds niets van dat volgens Sovon c.s. jaar in jaar enkele duizenden Taigarietganzen in Nederland overwinteren (zie helemaal achterin de jaarlijkse wavo-rapporten in de bijlagen met aantallen per maand en per provincie), terwijl mensen zoals jij en anderen ze maar niet kunnen vinden čn fotograferen. Het laatste vind ik een erg belangrijk item. Doet me soms ook denken aan de Ivoorsnavelspecht. Ladingen hooggeleerde heren (en dames?) die bij hoog & bij laag beweerden dat Ivoorsnavelspecht nog in de VS voorkwam. Maar foto's? Ho maar. Terwijl ongetwijfeld >200 fotografen staan te trappelen om enkele maanden in dat gebied door te brengen om er wat platen van te maken?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 05, 2010, 16:08:08 pm
Even wat gespeeld tijdens de lunch nav de anova van Ruokonen et al. Het kan best zijn dat de desbetreffende verdeling voor mannen en vrouwen samen redelijk normaal is, maar dan nog schiet je jezelf wel in de voet door een inefficiënte analyse uit te voeren. Met een anova test je feitelijk of het verschil in gemiddelde tussen 2 groepen (hier Taiga en Toendra) groter is dan je zou mogen verwachten op basis van de verschillen binnen deze groepen. Door geslacht te negeren (en dat doen ze zeer waarschijnlijk, staat nl. ook niet in de bijlage) is je schatting van de verschillen binnen de groepen hoger dan wanneer je daar wel voor zou corrigeren en wordt het dus moeilijker om te concluderen dat het verschil in gemiddelde tussen de groepen niet op toeval berust.

Heb 2 plaatjes bijgevoegd waarmee dat hopelijk duidelijk wordt. Ik heb hiervoor de schattingen voor het gemiddelde en de standaard-deviatie voor de snavellengte gebruikt uit BWP. Rood is fabalis, blauw is rossicus. In figuur 1 geven de stippellijnen de kansdichtheid weer voor de verschillende snavellengtes per geslacht (vrouwen kortere snavel dan mannen) voor een enkel individu. De dikke doorgetrokken lijn is de kansverdeling op basis van de geschatte normale verdeling wanneer je 10 mannen en 10 vrouwen bij elkaar gooit (zoals die dus in een anova gebruikt zou worden) en de dunne doorgetrokken lijn is de empirische verdeling die je krijgt door die 2 groepen te combineren (en zou dus 2-toppig kunnen zijn). Zoals je kunt zien is het verschil tussen beide verdelingen (iig voor snavellengte) niet zo groot, dus het negeren van geslacht heeft hier niet direct tot gevolg dat je geen anova zou mogen gebruiken. In figuur 2 heb ik opnieuw de gecombineerde verdeling weergegeven met een dikke lijn, maar nu samen met de verdeling die je krijgt door te corrigeren voor geslacht (de dunne lijn). Je ziet dat de spreiding binnen die laatste verdeling iets kleiner is waardoor je hogere, smallere pieken krijgt en het verschil tussen 2 groepen daardoor sneller statistisch significant zal zijn. Zoals gezegd zijn er echter wel meer redenen om aan die morfologische analyses te twijfelen.


@Herman:
Als je het hebt over die gebrekkige support refereer je naar de maximum parsimony analyses. Ruokonen et al. beargumenteren dat de Bayesiaanse analyses beter zijn omdat ze gebruik maken van een expliciete likelihood-functie. Daarin ligt de support een stuk hoger en ik ben op zich wel gevoelig voor hun argument. Ik heb echter het paper dat ze aanhalen niet gelezen (ligt nog ergens onder op een stapel) en weet niet genoeg van dit soort analyses om te kunnen zeggen wat de beste manier is (als die er al is). Heb jij daar een uitgesproken mening over?

@Klaas:
Veel hangt af van wat je nog een Taiga vind. Je gaat nooit 1000en vogels als die van Edwin de Weerd vinden, maar als ik ook wat minder mooie beesten mee mag tellen haal ik er toch zeker wel 100-200 per winter (en ik kom vrijwel nooit buiten een straal van ca. 30km van Den Bosch om ganzen te kijken). Moet echter zeggen dat ik nav deze discussie (tijdelijk?) wat strenger ben geworden, maar denk dat de absolute ondergrens voor dit deel van Midden-Brabant toch in de buurt van de 30-40 ex. per winter ligt (+ dan nog de nodige rietgans specs).

Vogel is inderdaad van Utterslev Mose:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26210
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26236
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26245
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26246
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=27342

Ook op Bornholm heeft er trouwens een vogel rondgehangen:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=30525
http://www.dof-bornholm.dk/observationer/rossicus-paa-afveje/
http://www.dof-bornholm.dk/observationer/rossicus-i-roenne-havn/

Overigens hadden we ook in NL meerdere overzomerende rietganzen, o.a. een groepje op de Chaamse Heide bji Breda (al zijn die in 2009 niet meer gemeld geloof ik).

Lützen
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 05, 2010, 17:29:46 pm
He, dit topic een beetje gemist. Het staak ook allemaal zo verspreid. Wat opmerkingen over de genetische analyse van mijn kant. Ik heb het (nog) niet allemaal doorgelezen dus misschien zeg ik iets dubbels. Sorry daarvoor.

Bayesian support valt gewoonlijk hoger uit dan bootstrap support. Pas >0.95 wordt als voldoende aangenomen. Hoewel het fabalis clade-je zelf goed ondersteund wordt valt deze (alles minder dan 0.95 collapsen) in een groep met rossicus en serrirosicus. Het netwerk laat dat ook wel aardig zien. Hoewel de fabalis clade te scheiden is van die twee is dat andersom dus niet het geval.

Belangrijk(er) is ook om naar de geografische oorsprong van die haplotypen te kijken. Hiervoor moet je naar de supplementary info bij het artikel gaan. Hieruit blijkt dat het haplotype netwerk een misleidend beeld geeft. De genetische clades stemmen niet een op een overeen met de taxonomie. FAB komt voor in rossicus gebied etc. Daarbovenop worden verschillende haplotypen (bv FAB en ROS) aangetroffen binnen een enkele populate (voor zover je kan populaties kan spreken, maar wel populaties die hoe dan ook binnen het verspreidingsgebied van de taxa als aangehouden in het artikel). De populatie waar MID en FAB samen voorkomen zou je nog van een aangrenzen areaal kunnen spreken maar dat gaat in andere gevallen niet op. Ik heb het even in excel gezet en geordend op populatie, zie bijgevoegd.

Er zijn dus verschillende redenen om de genetische resultaten als niet ondersteunend voor de huidige taxonomische treatment te zien binnen de FAB/ROS/SER groep. De optie dat de taxa wel evolutionary independent zijn maardat er gewoon te weinig tijd verstreken is om dit te doen uitkristaliseren in de vorm van monophyletische groepen (incomplete lineage sorting) wordt tegen gegaan door het voorkomen van verschillende haplotypen binnen een enkele populatie. Gene flow lijkt beter te passen.

Beesten die je in het veld tegenkomt echt een label Taiga of Toendra te geven lijkt me in dit licht gewoon niet zo zinvol aangezien dat geen natuurlijk gescheiden groepen lijken te zijn. Proberen de geographische herkomst van types te bepalen is een veel interessantere opgave.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 05, 2010, 17:49:38 pm
Veel hangt af van wat je nog een Taiga vindt. Je gaat nooit 1000en vogels als die van Edwin de Weerd vinden, maar als ik ook wat minder mooie beesten mee mag tellen haal ik er toch zeker wel 100-200 per winter (en ik kom vrijwel nooit buiten een straal van ca. 30km van Den Bosch om ganzen te kijken). Moet echter zeggen dat ik nav deze discussie (tijdelijk?) wat strenger ben geworden, maar denk dat de absolute ondergrens voor dit deel van Midden-Brabant toch in de buurt van de 30-40 ex. per winter ligt (+ dan nog de nodige rietgans specs). Vogel is inderdaad van Utterslev Mose: http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26210 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26210)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26236 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26236)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26245 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26245)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26246 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=26246)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=27342 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=27342)
Ook op Bornholm heeft er trouwens een vogel rondgehangen: http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=30525 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=30525)
http://www.dof-bornholm.dk/observationer/rossicus-paa-afveje/ (http://www.dof-bornholm.dk/observationer/rossicus-paa-afveje/)
http://www.dof-bornholm.dk/observationer/rossicus-i-roenne-havn/ (http://www.dof-bornholm.dk/observationer/rossicus-i-roenne-havn/) Overigens hadden we ook in NL meerdere overzomerende rietganzen, o.a. een groepje op de Chaamse Heide bji Breda (al zijn die in 2009 niet meer gemeld geloof ik). Lützen
hoi Lützen,
Had ik het dus toch wel goed gezien. M.i. een (zeer) makke / broodtamme vogel, net zoals de meeste Grauwe Ganzen die daar broeden. Voer in Utterslev Mose de meeuwen (of de eenden) en binnen korte tijd heb je een flinke groep bedelende Grauwe Ganzen om je heen staan. M.i. zijn de meeste foto's van erg dichtbij genomen. Ik kan me niet (meer) herinneren of hier ook exoten etc. rondzwommen (Utterslev Mose is zeer groot). Wel hopen Knobbelzwanen die je soms bijna omver duwen. Dat Bornholm-beest is ook wel een leuke. De eerste foto is een gans op een havenpier zo te zien net zo mak als een broodtamme Zilvermeeuw in de haven van Lauwersoog. De Deense teksten kan ik niet zo goed lezen (het lijkt of deze gans krentenbollen eet), maar of het wel een wilde vogel is???? Er heeft ook jarenlang een tamme Brandgans in een park in de stad Groningen rondgelopen.
 
Tja, volgens Sovon cs. zitten er toch jaarlijks echt wel enkele duizenden Taigarietganzen in Nederland. En dan kun je wel zeggen dat het merendeel hiervan 'minder mooie beesten' zijn, of 'nog Taigarietganzen afhankelijk waar je de grens trekt', maar doe je dat ook bij pakweg Pontische Meeuw versus Zilvermeeuw (of bij Baltische Mantelmeeuw versus Kleine Mantelmeeuw)?
 
't Klinkt misschien wat raar, maar ik begrijp er niets van dat je dus - kennelijk- twee soorten ganzen (want volgens CSNA/CDNA/DBA/Sovon gaat het om twee soorten) in Nederland in het veld (heel?) vaak niet uit elkaar kunt houden. Want daar komt je betoog toch uiteindelijk wel op neer? Enkele duizenden ganzen waarvan je niet met zekerheid kunt zeggen of het dan wel Toendrarietganzen dan wel Taigarietganzen zijn. Fatsoenlijke genetische verschillen zijn er, in ieder geval volgens Ruokonen ea, ook nauwelijks / onvoldoende. En dat terwijl ganzen in familieverband voorkomen, dus bij wat beter kijken in het veld precies is vast te stellen wie met wie is gepaard, of er jongen bijlopen etc.
 
@Herman, bedankt voor je verhelderende uitleg! Ik moet inderdaad mijn kennis flink wat oppoetsen.
 
Interessant blijft dat hele volksstammen nog steeds Taigarietganzen blijven invoeren zie o.a. http://waarneming.nl/soort/view/338 (http://waarneming.nl/soort/view/338) . De enkele foto die bijgevoegd is geeft meestal Toendrarietgans of een erg daarop lijkende vogel op. Blijkbaar volgen dus weinig mensen deze discussie gezien het aantal beesten wat dus structureel wordt ingevoerd.
hoi Justin,
Reden temeer om deze discussie wel te blijven voeren en om zoveel mogelijk foto's te maken en online te zetten. Een enorm verschil met vroeger (pakweg 20 jaar geleden en langer), want toen was (digitale) fotografie nog lang niet zo breed verspreid. En de foto's zullen -voorlopig- uiteindelijk de doorslag moeten geven, want dan weet we in ieder geval waar we het over hebben.
Toendrarietgans, Taigarietgans en 'rietgans ongedetermineerd' staan alle drie op de (digtale) wavo telformulieren van Sovon. Maar als je eens wat snuffelt in de bijlagen (helemaal achterin) van de jaarlijkse Sovon wavo rapporten zie je per provincie en per maand gewoon allerlei totalen van Taigarietganzen staan (zonder asteriks, sterretje of wat dan ook). En totalen van Taigarietgans staan ook wel in allerlei andere tabellen in de bijlage. Dus waarom eraan twijfelen? Want volop Taigarietganzen in de Sovon wavo rapporten. Maar 'rietgans ongedetermineerd' kan ik nergens terugvinden in deze tabellen (niet alles doorgenomen, 'canadese gans' staat wel vermeld).
 
 
Tot slot nog weer even een scan van een tweede artikel uit de rietganzenspecial van Watervogels uit 1977. Huyskens heeft -later- veel meer geschreven over Rietganzen, maar die artikelen heb ik niet.
 
Groetjes, Klaas
 
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 05, 2010, 19:43:29 pm
Poe he, het was een flinke kluif, maar ik ben bij pagina acht aangekomen. Eerder post was inderdaad wat dubbelop maar voegt hopelijk nog net iets toe.

Grappig de vergelijking met Witkopstaartmees die eerder gemaakt werd. Die wordt braaf als ondersoort behandeld en een brede overgangszone wordt erkend. In praktijk worden alleen de uiterste extremen als Witkop geaccepteerd in NL. En intermediaire beesten? Die zouden dan Europese Staartmees (als ik 'm zo mag noemen) genoemd worden?  Stel je bent een vogelaar aan de oostkant van de Hybridezone, hoe zou je dan een Europese Staartmees (stoere dwaalgast) afmaken en wat zou je met intermediairen doen?

Het is niet onwaarschijnlijk dat rietgans-vormen ook clinaal overlopen. Sommige mensen lijken in NL alle intermediaire graag bij Toendra te scharen en alleen extremen Taiga te noemen en op andere locaties gebeurt dat juist weer andersom, dus staartmeesachtig. Kan je uberhaubt stellen dat er maar twee morfologische extremen binnen de rietganzen zitten (dan ff zonder middendorfi) en niet drie of meer? Die suffe dichotomie doet de werkelijke situatie geen recht.

Puinhoop! Maar wel intrigerende puinhoop.
Titel: Re: rietgans, again...
Bericht door: marijn op februari 06, 2010, 01:14:22 am
Even tussendoor (fantastisch hoe Ruokonen uitgeplozen wordt!): misschien heb ik ergens wat informatie gemist, maar waarom zou Max (en anderen) hier aan Middendorff denken?:
http://www.dutchbirdalerts.nl/report.action?id=18794
http://waarneming.nl/waarneming/view/46280768#

Mooie vogels, maar wat ik tot nu toe op het (oostelijke) www van middendorffi gezien heb, ziet er toch nog even anders uit (zal eens wat plaatjes bij elkaar zetten).
De Drentse vogels doen mij meer aan de Finse van Hannu Huttu denken, bijv. http://www.hannuhuttu.com/gallery/displayimage.php?album=search&cat=0&pos=34 en http://www.hannuhuttu.com/gallery/displayimage.php?album=search&cat=0&pos=44.

Overigens hoop ik ook nog altijd op scans van de Vogeljaar-herkenningsartikelen van Leo v.d.B... Wie weet wat daarin staat over johanseni en middendorffi &c.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op februari 06, 2010, 08:21:53 am
Max "denkt aan niet zo veel" bij deze vogels maar wilde graag (in tegenstelling tot wat vaker aan het eind van het weekend gebeurd) een discussie die via een mailgroepje van belangstellende waar ik in zit naast dit forum, doorgeven dat er mensen zijn die Middendorff bij de Emmen vogels als serieuze mogelijkheid optie geven. Nu heb je een heel weekend om er heen te gaan als je dat wil, leuk te combineren met meer klassieke fabalis vogels in dezelfde hoek en van dezelfde waarnemer.
 
Nu Middendorff is afgesplitst door de CSNA (waar ik geen oordeel over heb) is deze soort een serieuze nieuwe soort om te vinden in NL (staat immers geen bewezen geval hiervan op de lijst)
 
Het mailgroepje concludeerde overigens gisteren dat deze vogels te klein lijken voor Middendorff's
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op februari 06, 2010, 09:00:41 am
Hier de foto`s, leuke beesten flinke toeters, toch weer heel anders als de vogels eerder deze week.
 
Edwin.
Titel: Re: rietgans, again...
Bericht door: redmar_woudstra op februari 06, 2010, 11:45:44 am
Jij weet wel fraaie beesten te vinden Edwin! Het zal desondanks nog wel een monnikenwerk zijn ze uit al die toendra's te plukken!
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 06, 2010, 15:00:42 pm
Daarbovenop worden verschillende haplotypen (bv FAB en ROS) aangetroffen binnen een enkele populate (voor zover je kan populaties kan spreken, maar wel populaties die hoe dan ook binnen het verspreidingsgebied van de taxa als aangehouden in het artikel). De populatie waar MID en FAB samen voorkomen zou je nog van een aangrenzen areaal kunnen spreken maar dat gaat in andere gevallen niet op. Ik heb het even in excel gezet en geordend op populatie, zie bijgevoegd.
Vooral de plekken Kola Peninsula en Novaja Zemlja (Nova Zembla) hebben een opvallende mix van haplotypen -- beide plekken hebben SER(rirostris), FAB(alis) en ROS(sicus). Ben te lui om dit nu te checken, maar kan dit niet deels of vooral komen doordat er zowel trek- als broedvogels zijn gesampled? Dat laatste noemde Klaas eerder. Wanneer dit allemaal lokale broedvogels zouden zijn, zou het inderdaad absoluut een grote bende zijn.
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 06, 2010, 15:10:06 pm
Maar de optie trekvogels wat betreft fabalis zou niet logisch zijn daar toch?
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 07, 2010, 19:43:54 pm
Vooral de plekken Kola Peninsula en Novaja Zemlja (Nova Zembla) hebben een opvallende mix van haplotypen -- beide plekken hebben SER(rirostris), FAB(alis) en ROS(sicus). Ben te lui om dit nu te checken, maar kan dit niet deels of vooral komen doordat er zowel trek- als broedvogels zijn gesampled? Dat laatste noemde Klaas eerder. Wanneer dit allemaal lokale broedvogels zouden zijn, zou het inderdaad absoluut een grote bende zijn.
Maar de optie trekvogels wat betreft fabalis zou niet logisch zijn daar toch?
hoi Jelmer en Ben,
 
Hangt af wat je verstaat onder 'trekvogel', maar ook wat je verstaat onder toendra en taiga. Broedt iedere Toendrarietgans per definitie op de toendra en broedt iedere Taigarietgans per definitie op de taiga? En kun je dit ook omkeren? Dus is iedere 'rietgans' die op de toendra broedt per definitie een Toendrarietgans, en is iedere 'rietgans' die in de taiga broedt per definitie een Taigarietgans? Bovendien heb je een heleboel typen toendra (zie bv het boek 'The living tundra' van Y. Chernov). Een kaartje met wat verschillende typen toendra en taiga in Centraal Siberië staat ook in één van de scans (zie eerder) die ik van het boek van Rogacheva heb gemaakt.
 
Daarnaast vertonen veel soorten ganzen ruitrek. Bij de (sub)actische ganzen gaat het daarbij uitsluitend om niet-broeders / mislukte broeders etc. (succesvolle broedvogels ruien hun slagpennen in de periode dat hun jongen nog niet kunnen vliegen). En deze ruitrek kan best wel over (zeer) grote afstanden plaatsvinden (vast wel > 1000 km) en van een taigaregio naar een toendraregio. De (giga)grote delta's van diverse Russische rivieren die in de Noordelijke IJszee uitmonden zijn hiervoor zeer geschikt (bv Pyasina op Taimyr. kijk maar eens op GE). Nova Zembla is vast ook wel geschikt voor ruiende ganzen? Misschien staat er wel iets over in de klassieker van Uspenskii (Life in high latitudes, 1984). Tegelijk is hier ook weer niet al teveel van bekend. Je moet je ook niet blindstaren over wat er allemaal bekend is uit Rusland / de Sovjet Unie. Vaak is er bitter weinig bekend. Mede daarom een scan gemaakt van het hoofdstuk 'rietgans' van de avifauna van Centraal Siberië (want dat gaat vooral over de Sovjet-Unietijd). Trinus gaf een mooie link over onderzoek / tellingen etc. uit vooral de Rusland-tijd http://ornitology.krasu.ru/files/goos.pdf (http://ornitology.krasu.ru/files/goos.pdf)
 
Veel van wat in Nederland is geschreven over "rietganzen" komt van de hand van Leo van den Bergh, vermoedelijk inclusief de soortteksten in de recentelijk verschenen SOVON-rapporten (dus inclusief de tegenstrijdige informatie in die laatste rapporten). De vraag is m.i. gerechtvaardigd in hoeverre alles wat door hem geschreven is als betrouwbare informatie beschouwd moet worden (kom hier later nog op terug).
Ik heb de artikelen uit 2003 en 2004 van Leo van den Bergh over het voorkomen van Rietganzen rond Nijmegen en in Drenthe nog eens doorgenomen. (...). Een aantal zaken die verder opvallen. Over alle (onder)soorten wordt met een bepaalde vanzelfsprekendheid geschreven. Anser fabalis johanseni en Anser serrirostris serrirostris worden in groepen van respectievelijk vele honderden of zelfs duizenden waargenomen alsof dat allemaal heel normaal zou zijn. Tevens worden herhaaldelijk kleine (familie)groepjes Anser (fabalis) middendorffi gezien. Ook wordt in het artikel over Drenthe bijna terloops en kritiekloos opgemerkt dat door een waarnemer 7625 Anser serrirostris serrirostris rond het Fochteloerveen werden waargenomen. Dit terwijl de populatie die in Oost-Azie broedt op slechts circa 55.000 vogels wordt geschat (schattingen lopen uiteen van 45.000 tot 65.000). De 1% norm voor deze ondersoort is 550 vogels. Dat zou dus betekenen dat het Fochteloerveen van internationale betekenis is voor deze bedreigde Oost-Aziatische ondersoort! De norm wordt zelfs 13 keer overschreden! Het verhaal dat er meer vogels van oostelijke herkomst naar Nederland komen doordat de vogels die vroeger in het Pannonische gebied (zeg maar Hongarije en omgeving) overwinterden en dat nu in Nederland doen suggereert dat in het Pannonische gebied traditioneel "rietganzen" van oostelijke herkomst zouden overwinteren. Volgens mij is dat nog nooit vastgesteld. Ook dat leap-frog verhaal klinkt heel interessant, maar er is m.i. geen enkele aanwijzing voor. Voorzover mij bekend is er buiten Leo van den Bergh niemand die ooit heeft gepubliceerd over het voorkomen van "oostelijke rietganzen" in Europa, zeker niet in de aantallen die hij zegt te zijn tegengekomen bij zijn veldwerk. Het enige bewijs voor deze "oostelijke rietganzen" zijn de waarnemingen van Leo van den Bergh. Dat is natuurlijk nogal mager bewijs. Als het echt zo zou zijn dat "rietganzen"" van zo oostelijk in Nederland zouden kunnen worden aangetroffen dan zou dat m.i. tamelijk sensationeel zijn en zou een artikel in een serieus ornithologisch tijdschrift wel op z'n plaats zijn. (...). Totdat het tegendeel bewezen is lijkt het mij verstandig om uit te blijven gaan van het voorkomen in Nederland van slechts 2 soorten of ondersoorten "rietganzen", namelijk de Taigarietgans Anser (fabalis) fabalis en Toendrarietgans Anser serrirrostris rossicus (of Anser fabalis rossicus). En in de praktijk dus tegenwoordig alleen nog maar de Toendrarietgans Anser serrirostris rossicus. Kan het nog overzichtelijker?
hoi Trinus,
Ik zat nog eens even wat te bladeren in de monumentale & uitputtende 'Avifauna van Limburg' uit 2006 (ongetwijfeld bij Max en Justin in de kast). Er staan bij Grauwe Gans en bij Rietgans een aantal uitspraken die goed overeenkomen met wat jij hierboven zegt.
 
Grauwe Gans (pagina 123): 'Van de Siberische Grauwe Gans A. a. rubrirostris, de oostelijke ondersoort, zijn zes waarnemingen van in totaal 260 individuen aan het Vogelarchief doorgegeven. Ze stammen alle uit het Maasdal, in de periode 1965-88. Geen enkel geval is echter voldoende gedocumenteerd om de determinatie te kunnen staven. Ook landelijk gezien zijn er geen aanvaarde waarnemingen van wilde vogels bekend (van den Berg & Bosman 2001), al is een enkeling het hier niet mee eens (van den Bergh 2002).' Deze referentie is een artikel van Leo in het Vogeljaar (jaargang 50, pagina 195-200) over rubrirostris.
 
Taigarietgans (pagina 114-115):
(1): 'Na de milleniumwisseling is de soort zeer schaars geworden en gaat het meestal om een handvol vogels, een uitzondering daargelaten (32 op 18 januari 2003 in de Mariapeel). De meldingen van enkele honderden vogels in de Kop van Limburg door Van den Bergh (2003) verdienen nadere studie.' Deze referentie is het artikel van Leo in de Mourik (deel 1, pagina 90-97) wat je eerder al eens noemde.
(2): 'Het door Bossenbroek (1987) opgegeven maximum van 1800 vogels in de zachte winter van 1980/81 is vanwege determinatieproblemen twijfelachtig. Na de strenge winter van 1995/96 zijn de aantallen sterk verminderd. Vermoedelijk blijven veel Taigarietganzen nu noordelijker in Europa hangen (Bijlsma et al. 2001). Volgens Van den Bergh (2003) zijn de 'geelbekken' vanaf midden jaren negentig vervangen door zwartsnavelige dieren die vermoedelijk beoosten de Oeral broeden. Goede fotografische documentatie ontbreekt echter tot op heden." Weer dus hetzelfde artikel uit de Mourik.
(3): 'Alle in het broedseizoen ten oosten van de Oeral teruggemelde en in Nederland geringde rietganzen zijn Taigarietganzen. In het verleden werd gedacht dat rietganzen uit dit broedgebied tot de ondersoort A. f. johanseni zouden behoren. Dit wordt door sommigen ontkend (het zou eerder de nominaatvorm A. f. fabalis betreffen; Burgers et al. 1991) en door anderen bevestigd (van den Bergh 2003a).' Hierbij wordt gerefereerd aan een artikel van Leo in het Vogeljaar (jaargang 51, pagina 58-64, 'De Westsiberische Taigagans of Johansens Gans').
(4): er staat geen foto van een Taigarietgans in het boek. Kan toeval zijn (bij bv. Regenwulp en Carolina-eend staat ook geen foto), maar kan ook betekenen dat er gewoon geen foto bestond van een Limburgse Taigarietgans (alle foto's zijn in Limburg gemaakt & bij praktisch iedere soort staat wel een foto).
 
Dus ook in Limburg (erg) veel twijfels over de waarnemingen & publicaties van Leo.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 07, 2010, 20:14:47 pm
Citaat
Hangt af wat je verstaat onder 'trekvogel',

Ik hoopte dat jij de tabel nog even ging doorspitten om te zien of er een patroon in de gesamplede dieren en haplotypen zat ;-)

Citaat
maar ook wat je verstaatonder toendra en taiga. Broedt iedere Toendrarietgans per definitie opde toendra en broedt iedere Taigarietgans per definitie op de taiga? Enkun je dit ook omkeren? Dus is iedere 'rietgans' die op de toendrabroedt per definitie een Toendrarietgans, en is iedere 'rietgans' diein de taiga broedt per definitie een Taigarietgans?

Ja dat is ook nog maar de vraag natuurlijk. Als je zelfs niet voor enige vorm van een duidelijke ecologische isolatie kunt spreken tussen de twee (of drie, of vier, of n vormen, wat hou je dan nog over?
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 08, 2010, 09:58:21 am
Ga later nog eens lezen, maar is dit geen Zweedse halsband? Of worden die inmiddels ook elders gebruikt?
 
http://waarneming.nl/waarneming/view/46312821 (http://waarneming.nl/waarneming/view/46312821)
 
Lutzen
 
zie bijv http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/MARKING_BEANS.htm (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/MARKING_BEANS.htm)
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 08, 2010, 10:40:11 am
Dus ook in Limburg (erg) veel twijfels over de waarnemingen & publicaties van Leo.

Je kunt je wel afvragen in hoeverre dat wat zegt. De (in mijn ogen ongezonde) neiging om alle variatie onder rossicus te willen schuiven en niks te accepteren van fabalis zorgt dat er altijd wel iemand is die ergens twijfels over heeft:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=2229&page=1 (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=2229&page=1)

Vergelijk die snavels eens met die van de linkervogel in figuur 27 uit dat artikel van Barthel. Niks aan de hand toch? Of zijn dat nu plotseling ook fors uitgevallen Toendrarieten ;)

Lutzen

ps. vergelijkbare vogels hier (beetje naar onderen):

http://www.digimages.info/oiemoi/oiemoi.htm
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 15:42:36 pm
Ik hoopte dat jij de tabel nog even ging doorspitten om te zien of er een patroon in de gesamplede dieren en haplotypen zat.
Goed.
 
Eerst maar eens een lijst van alles van de regio Nova Zembla, Vaygach & het Yugorski schiereiland (ligt naast elkaar en is allemaal toendra).
 
FAB1 Nova Zembla 16 juli 2002 (adult met maten, niet in slagpenrui)
FAB6 Nova Zembla 24 juli 1907 (adult met maten, niet in slagpenrui)
SER1 Nova Zembla 24 mei 1903 (adult met maten, niet in slagpenrui)
SER1 Nova Zembla dag/maand/jaar onbekend (geen maten, leeftijd onbekend, museum Moskou)
ROS2 Nova Zembla 4 aug 1997 (adult met maten, geen vleugellengte, kennelijk dus in slagpenrui)
ROS2 Nova Zembla 18 aug 1903 (adult met maten, niet in slagpenrui)
 
Dus van Nova Zembla al 3 taxa verzameld. Dus FAB vogels (=fabalis) op de toendra in Nova Zembla. En het is daar echt dikke toendra hoor (deels zelfs polar desert). En volgens GE zeker 1500 km ten westen van het meest dichtbijzijnde broedgebied van serrirostris (volgens kaart op pag 555 van Ruokonen). Van de ene SER is ongeveer niets bekend, de andere SER is >100 jaar geleden verzameld.
 
SER1 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
ROS2 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
ROS2 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
 
Nou, dat is ook grondig gedocumenteerd allemaal....... En ook Vaygach (een eiland net onder Nova Zembla) ligt zeker 1500 km ten westen van het meest dichtbijzijnde broedgebied van serrirostris.
En dat het aangrenzende schiereiland Yugorski.
 
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
 
Ook dus maar 'matig' gedocumenteerd. Wellicht iets dichter bij (minder dan 1500 km) bij het meest dichtbijzijnde broedgebied van serrirostris? Maar de SER vogels zijn in ieder geval niet >100 jaar geleden verzameld, dus ideeën over veranderingen van broedgebieden in de loop van de tijd (door global warming of whatever) kun je naar het rijk der fabelen verwijzen?
 
Wel grappig / vreemd / verontrustend dat er dus 6 serrirostris monsters uit dit gebied komen (en dan ook nog eens zowel uit Nova Zembla, Vaygach als van het Yugorski schiereiland). Je zou deze regio, gezien de kaart op pag 555 toch echt karakteriseren als het kerngebied van rossicus. Wel allemaal van het haplotype SER1. Hoe zeker is eigenlijk dat haplotype SER1 behoort tot het taxon serrirostris? Of is dat gewoon een aanname?
 
En dan is er ook nog de geheimzinnige ROS4 vogel. Verzameld op 12 mei 1959 in 'Krasnojarsk' (maar waar ergens?) als adult (museumvogel, alle maten genomen) die '(...) based on mtDNA was placed into the rossicus group (the sole carrier of ROS4 haplotype).' Qua maten etc. nergens thuis te brengen volgens de tekst (maar geen wonder als er veel overlap is), maar dus een rossicus. Hoe zeker? Waarom hoort dit haplotype niet ergens anders bij? Of is het een kruising / hybride of whatever?
 
Ben benieuwd wat je & anderen hiervan vinden.
 
Een patroon lijkt er nauwelijks te zijn. Nou ja, terug naar de 'good old' Rietgans Anser fabalis? En/of concluderen dat er zowel in het veld als in het lab vaak niet uit is te komen (wat dus goed pleit voor één soort)? Waarom zijn vogelclubjes in allerlei landen (& ook internationale groepen) eigenlijk nooit meegegaan met George Sangster c.s. om Rietgans te splitsen in Toendrarietgans / Taigarietgans?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 16:07:12 pm
Ik denk dat we in de eerste plaats niet te veel aan de namen die ze aan de haplotypen hebben meegegeven moeten hangen!
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 08, 2010, 16:45:55 pm
Maar de optie trekvogels wat betreft fabalis zou niet logisch zijn daar toch?
Twee van de 4 Taigarietganzen die in Noord-Zweden in 2009 werden uitgerust met satelietzenders gingen in de loop van de zomer naar Nova Zembla. In 2008 was dat 1 van de 3. Totaal dus 3 van de 7. Het lijkt er op dat Taigarietganzen op Nova Zembla kunnen ruien. Zie voor enige details hierover: http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/SATTELIT-GEESE.htm (http://www.zoo.ekol.lu.se/waterfowl/BEANGOOSE/SATTELIT-GEESE.htm)
Dat kunnen eventueel ook A.s.serrirostris (of A.fabalis serrirostris) doen of vroeger hebben gedaan, maar dan vanuit het oosten. Dus her en der kunnen in de zomer de verschillende soorten en ondersoorten opduiken, zonder dat ze een relatie met dat gebied hebben als broedgebied.
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 08, 2010, 16:50:27 pm
Ga later nog eens lezen, maar is dit geen Zweedse halsband? Of worden die inmiddels ook elders gebruikt?
http://waarneming.nl/waarneming/view/46312821 (http://waarneming.nl/waarneming/view/46312821)
Volgens mij is dit een in Nederland aangelegde halsband. Circa 10 jaar geleden zijn enkele tientallen Rietganzen "per ongeluk" gemerkt met zwarte halsbanden die voor Kolganzen bestemd waren. Ik zal even nagaan of 1 van de toen geringde exemplaren voldoet aan het gedeelte van de code dat op de foto zichtbaar is. 
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op februari 08, 2010, 16:57:19 pm
Je hebt zo ook Kolganzen met gele halsbanden, Gewoon een bijvangst (en andere halsbanden op?). De Taiga's zouden met blauw zijn gehalsband.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 08, 2010, 17:07:27 pm
Hoe zeker is eigenlijk dat haplotype SER1 behoort tot het taxon serrirostris? Of is dat gewoon een aanname?

Deze vogels rekenen ze zelf ook (fenotypisch) tot rossicus volgens mij. In de bijlage hebben ze de (oude & hergedetermineerde) fenotypes helaas niet gegeven dus het is even zoeken. Voor de rest (mid, fab, bra) gaan ze volgens mij wel uit van 1:1 correspondentie tussen haplotypes en fenotypes, al valt daar zelfs van een afstandje wel wat op af te dingen (bijv. voor die FAB1 vogels van Tomsk Oblast). Ben het met Ben eens dat we niet teveel aan die namen moeten hangen, maar betekent dat nu ook dat we daarmee hebben aangetoond dat Toendra en Taiga geen goede soorten zijn? Als dat boompje in fig. 2 in orde is kun je toch altijd nog aanvoeren dat alleen de determinatie van de vogels niet klopt (door problemen in sampling+herkenning)? Of mis ik nu iets? Moet toegeven dat ik nog steeds moeite heb dat figuur te interpreteren. Begrijp ik nu goed dat in de Bayesiaanse analyse Kleine Rietgans in 97/100 herhalingen los van de rest van de rietganzen kwam te staan (82/10 voor de max.parsimony), maar fabalis in 99/100 herhalingen los van rossicus (en maar 59/100 voor de max.parsimony)?

Lutzen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 08, 2010, 17:11:34 pm
Je hebt zo ook Kolganzen met gele halsbanden, Gewoon een bijvangst (en andere halsbanden op?). De Taiga's zouden met blauw zijn gehalsband.

Ik dacht eerlijk gezegd dat het een blauwe halsband kon zijn (had niet aan zwart gedacht). Zal de schuld maar geven aan het schermpje van mijn laptop  :)

Lutzen
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 08, 2010, 17:47:22 pm
Ga later nog eens lezen, maar is dit geen Zweedse halsband? Of worden die inmiddels ook elders gebruikt?
http://waarneming.nl/waarneming/view/46312821 (http://waarneming.nl/waarneming/view/46312821)
Volgens mij is dit een in Nederland aangelegde halsband. Circa 10 jaar geleden zijn enkele tientallen Rietganzen "per ongeluk" gemerkt met zwarte halsbanden die voor Kolganzen bestemd waren. Ik zal even nagaan of 1 van de toen geringde exemplaren voldoet aan het gedeelte van de code dat op de foto zichtbaar is.
Er voldoet gelukkig maar 1 vogel aan het signalement, namelijk D AR. Deze vogel is als Toendrarietgans geringd op 8 december 2008 in de buurt van Leipzig door Thomas Heinicke. Hij zou eigenlijk met een gele halsband geringd moeten zijn, maar die waren op.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 18:05:14 pm
Ik denk dat we in de eerste plaats niet te veel aan de namen die ze aan de haplotypen hebben meegegeven moeten hangen!
Er zijn dus verschillende redenen om de genetische resultaten als niet ondersteunend voor de huidige taxonomische treatment te zien binnen de FAB/ROS/SER groep. De optie dat de taxa wel evolutionary independent zijn maar dat er gewoon te weinig tijd verstreken is om dit te doen uitkristaliseren in de vorm van monophyletische groepen (incomplete lineage sorting) wordt tegen gegaan door het voorkomen van verschillende haplotypen binnen een enkele populatie. Gene flow lijkt beter te passen. Beesten die je in het veld tegenkomt echt een label Taiga of Toendra te geven lijkt me in dit licht gewoon niet zo zinvol aangezien dat geen natuurlijk gescheiden groepen lijken te zijn. Proberen de geographische herkomst van types te bepalen is een veel interessantere opgave.
Maar wat blijft er dan over? De Rietgans Anser fabalis met allerlei ondersoorten die deels in elkaar overlopen?
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 18:19:03 pm
Citaat
Toendra en Taiga geen goede soorten

Tja, kan je zeggen dat er binnen de ros/ser/fab club twee vormen zijn die reproductief geisoleerd zijn en/of consistente verschillen in uiterlijk tonen? Zo simpel lijkt het niet te zijn toch? Er lijkt gezien de intergradatie en morphologische variatie toch meer aan de hand te zijn bij die rietganzen. (En wie weet doet mid daar gewoon gezellig bij mee, of die nou toevallig wel of niet een apart mtDNA takje vormt). Je gooit gewoon belangrijke informatie weg als je alleen 'taiga's' noteert die aan een of ander ideaal beeld voldoen (en waar is dat ideaalbeeld op gebaseerd?) en minder mooie beesten ongedetermineerd laat of, 'erger nog', toendra noemt. Zo ga je nooit patronen ontdekken.

Citaat
Als dat boompje in fig. 2 in orde is kun je toch altijd nog aanvoerendat alleen de determinatie van de vogels niet klopt (door problemen insampling+herkenning)? Of mis ik nu iets? Moet toegeven dat ik nogsteeds moeite heb dat figuur te interpreteren. Begrijp ik nu goed datin de Bayesiaanse analyse Kleine Rietgans in 97/100 herhalingen los vande rest van de rietganzen kwam te staan (82/10 voor de max.parsimony),maar fabalis in 99/100 herhalingen los van rossicus (en maar 59/100voor de max.parsimony)?

Bij bootstrappen (wat bij maximum parsimony en maximum likelihood analyses toegepast wordt) resample je de data steeds (deel DNA posities eruit mikken, sommige juist meerdere malen wegen) en bouw je steeds nieuwe boompjes, waardoor je een een mate vande support voor bepaalde groeperingen krijgt (op basis van de data die je er in stopt). Bij Bayesian werk je je door 'treespace' (de theoretisch mogelijke bomen, niet alleen verschillend in verwantschappen maar ook in taklengtes = mutaties) en sample je binnen een optimum (bagger bomen passen zo slecht op de data dat het programma die snel achter zich laat) bomen die sterk op elkaar gelijken maar niet helemaal identiek zijn (maar goed passend op de data die je er in stopt). Bayesian posterior probability moet je meer zien als een statistische ondersteuning. Ik begrijp niks van statistiek en ben al helemaal slecht in uitleggen, maar het komt er op neer dat je in praktijk bootstrap waardes van 80% of hoger en Bayesian ondersteuning van 0.95 of hoger vertrouwd. (En dan is het nog de vraag in hoeverre de data die je bestudeerd echt wat zegt over het de evolutionaire geschiedenis van de soort die je bekijkt.)
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 18:22:04 pm
Citaat
Maar wat blijft er dan over? De Rietgans Anser fabalis met allerlei ondersoorten die deels in elkaar overlopen?

Daar zou op zich toch niks mis mee zijn?
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 08, 2010, 18:31:24 pm
Dus ook in Limburg (erg) veel twijfels over de waarnemingen & publicaties van Leo.
Er kijken zoveel mensen serieus naar ganzen dat het wel heel raar is dat een aantal beweringen van 1 persoon zoveel invloed heeft. Vooral als die niet overeenkomen met wat al die anderen observeren. Voor alle zeldzame soorten moet er een commissie aan te pas komen om de waarnemingen te beoordelen. Dan kan natuurlijk niet voetstoots worden aangenomen dat als iemand meldt in een lokaal blaadje dat hij diverse families Anser (fabalis) middendorffii's heeft gezien dat dat dan klopt. Dus wat mij betreft terecht dat er kanttekeningen worden geplaats bij beweringen die niet zomaar voor waar aangenomen kunnen worden.   
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 18:45:41 pm
Citaat
Maar wat blijft er dan over? De Rietgans Anser fabalis met allerlei ondersoorten die deels in elkaar overlopen?
Daar zou op zich toch niks mis mee zijn?
Nee hoor. Lijkt me een strak plan. Dan zijn alle problemen gewoon opgelost. En lopen we bovendien weer in de pas met andere landen / organisaties / vogelclubjes etc.
 
Bovendien in lijn met de gang van zaken bij Baltische Mantelmeeuw. Via knip/plak uit hetzelfde fameuze peer-reviewed paper van Sangster et al (1999, Ardea 87, 1999); "Larus graellsii Lesser Black-backed Gull Kleine Mantelmeeuw // Larus fuscus Baltic Gull Baltische Mantelmeeuw. Lesser Black-backed Gull and Baltic Gull are specifically distinct based on qualitative differences in morphology and differences in moult and ecology (Barth 1968; Bergman 1982; Cramp & Simmons 1983; Hario 1992; Strann & Vader 1992; Jonsson 1998a)." Deze visie heeft ondertussen ook weinig / geen aanhangers meer.

Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 19:19:40 pm
Citaat
Dan zijn alle problemen gewoon opgelost.

Nou dat is wat optimistisch  ;) ! Het rietganzengebeuren is dermate interessant dat ik zowaar zou overwegen om ganzen te gaan kijken!
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 08, 2010, 19:25:47 pm
Citaat
Toendra en Taiga geen goede soorten

Tja, kan je zeggen dat er binnen de ros/ser/fab club twee vormen zijn die reproductief geisoleerd zijn en/of consistente verschillen in uiterlijk tonen? Zo simpel lijkt het niet te zijn toch? Er lijkt gezien de intergradatie en morphologische variatie toch meer aan de hand te zijn bij die rietganzen. (En wie weet doet mid daar gewoon gezellig bij mee, of die nou toevallig wel of niet een apart mtDNA takje vormt). Je gooit gewoon belangrijke informatie weg als je alleen 'taiga's' noteert die aan een of ander ideaal beeld voldoen (en waar is dat ideaalbeeld op gebaseerd?) en minder mooie beesten ongedetermineerd laat of, 'erger nog', toendra noemt. Zo ga je nooit patronen ontdekken.

Ben het helemaal met je eens hoor, maar wilde even duidelijk maken dat je de resultaten van de genetische analyse in dit geval niet om kunt draaien omdat niet helemaal duidelijk is of de juiste taxa gesampled zijn.

Ik begrijp niks van statistiek en ben al helemaal slecht in uitleggen, maar het komt er op neer dat je in praktijk bootstrap waardes van 80% of hoger en Bayesian ondersteuning van 0.95 of hoger vertrouwd. (En dan is het nog de vraag in hoeverre de data die je bestudeerd echt wat zegt over het de evolutionaire geschiedenis van de soort die je bekijkt.)

Eens kijken of ik het nu snap: het gaat om bootstrap waardes >80% EN Bayesiaanse posterior probabilities > 95%?

Lutzen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 08, 2010, 19:30:54 pm
(http://waarneming.nl/fotonew/2/1048462.jpg)(http://waarneming.nl/fotonew/1/1048461.jpg)
Nu we toch zo'n beetje alle geintresseerden, op dit op topic bij elkaar hebben, wat hebben we hier dan voor vogel....  Het was een grote vooral opvallende vogel (5 februari bij Langenboom).

Zie de mail van Albert voor een link, naar de foto op de Dutch Birding site.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 08, 2010, 19:31:46 pm
Mooi hoe hier op twee niveaus (taxonomisch & ID) door elkaar wordt gepraat. Ik me voorstellen dat bij veel waarnemingen toch de vraag naar de geografische afkomst en variatie zal blijven bestaan. Wat we sowieso niet moeten vergeten is om gewoon zo zorgvuldig mogelijk te blijven registeren.

Ik zie prachtige foto's uit Drenthe langskomen, maar daar mag best wat bij geschreven worden. Er hoeft niet eens direct over de afkomst gepraat te worden. Alleen al het omschrijven van wat je ziet, kan heel verschillend uitpakken:
http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2232&page=zoek (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2232&page=zoek)

Intrigerende vogels van Edwin, inderdaad (!): http://waarneming.nl/waarneming/view/46280768# (http://waarneming.nl/waarneming/view/46280768#) Ik doe een voorzetje. Ik zie denk ik zes adulten en een 1e winter (bruinige staarteind, vage kleurverdeling snavel en niet alle coverts geruid (?) en hoekig). Snavels lang en bovensnavels recht naar de nagel lopend. Geelverdeling: 4 vogels met geel onder het neusgat door (>50%) 3 met alleen een bandje. relatief lang lichaam. De ondersnavel buigt vanaf de basis net voorbij het neusgat de bovensnavel in en lijkt daarin te verdwijnen.

Ze deden me denken aan de terugkerende Franse vogels, die ik er qua snavels en bouw erg veel op vind lijken: http://www.digimages.info/oiemoi/oiemoi.htm (http://www.digimages.info/oiemoi/oiemoi.htm)  Daarvan denk ik dat de toendra/taiga-discussie snel uitgespeeld is, maar dat de vraag uit welk gebied ze komen wel boeiend is. Westelijke taigavogels, taigavogels uit C-Siberie?
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 20:26:55 pm
Citaat
Ben het helemaal met je eens hoor, maar wilde even duidelijk maken datje de resultaten van de genetische analyse in dit geval niet om kuntdraaien omdat niet helemaal duidelijk is of de juiste taxa gesampledzijn.

In principe laat de data hoe dan ook zien zien dat er weinig divergentie (in mtDNA) is binnen dit cluster rietgansen (bedenk dat het gebruikte mtDNA veruit het meest variabele stuk is) en er ook geen sprake is van structuur (er is geen initiele splitsing in een taiga clade en een toendra clade).

Citaat
Eens kijken of ik het nu snap: het gaat om bootstrap waardes >80% EN Bayesiaanse posterior probabilities > 95%?

Niet echt, een Baysian analyse geeft pp en een Maximum Parsimony bootstrap. Maximum Parsimony raakt een beetje uit de gratie aangezien het een beetje een te simplistisch beeld van sequence evolution geeft. Ik hecht meer waarde aan Bayesian (of Maximum Likelihood, wat wel weer veters aantrekken betekend).

Citaat
Mooi hoe hier op twee niveaus (taxonomisch & ID) door elkaar wordtgepraat. Ik me voorstellen dat bij veel waarnemingen toch de vraag naarde geografische afkomst en variatie zal blijven bestaan. Wat we sowiesoniet moeten vergeten is om gewoon zo zorgvuldig mogelijk te blijvenregisteren.

Helemaal mee eens. In dit geval zit de huidige taxonomie de boel juist dwars denk ik (in tegenstelling tot zo'n voorbeeld als de Kaapverdische Purperreiger).

Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 20:41:29 pm
Dus ook in Limburg (erg) veel twijfels over de waarnemingen & publicaties van Leo.
Er kijken zoveel mensen serieus naar ganzen dat het wel heel raar is dat een aantal beweringen van 1 persoon zoveel invloed heeft. Vooral als die niet overeenkomen met wat al die anderen observeren. Voor alle zeldzame soorten moet er een commissie aan te pas komen om de waarnemingen te beoordelen. Dan kan natuurlijk niet voetstoots worden aangenomen dat als iemand meldt in een lokaal blaadje dat hij diverse families Anser (fabalis) middendorffii heeft gezien dat dat dan klopt. Dus wat mij betreft terecht dat er kanttekeningen worden geplaats bij beweringen die niet zomaar voor waar aangenomen kunnen worden.
hoi Trinus,
Toch is er iets vreemds aan de hand m.b.t. het recente voorkomen van de Taigarietgans in Limburg in de Avifauna van Limburg. In de literatuurlijst staan ook de wavo-rapporten van Sovon van de winters 2000/01, 2001/02 en 2002/03. De wavo-rapporten van 2001/02 en 2002/03 hebben lijstjes met aantallen ganzen per soort, per maand en per provincie. En wat blijkt:
 
Limburg, wavorapport winter 2001/02, pagina 228, Taigarietgans:
okt 0
nov 0
dec 37
jan 54
feb 68
mrt 0
Limburg, wavorapport winter 2002/03, pagina 229, Taigarietgans:
okt 80
nov 230
dec 0
jan 44
feb 933
mrt 0
 
En niet met sterretjes, noten, getallen tussen haakjes o.i.d. die zouden aangeven dat er twijfel o.i.d. over bestaat. Maar in de Avifauna van Limburg staat bij Taigarietgans (zie ook hierboven):  'Na de milleniumwisseling is de soort zeer schaars geworden en gaat het meestal om een handvol vogels, een uitzondering daargelaten (32 op 18 januari 2003 in de Mariapeel). De meldingen van enkele honderden vogels in de Kop van Limburg door Van den Bergh (2003) verdienen nadere studie.' Maar er is dus nog een bron (namelijk twee wetenschappelijke rapporten van Sovon die gewoon in de lit. lijst van VvL staan) met hoge aantallen Taigarietganzen. Er rijzen een aantal vragen.
 
Waarom zijn deze Sovon-aantallen niet genoemd en vervolgens verworpen als 'niet betrouwbaar' o.i.d.? Vergeten? Of speelden pettenproblemen? Of hanteert Sovon andere provinciegrenzen dan de Avifauna van Limburg? Of staan er fouten in de database van Sovon? Of weet jij een betere verklaring?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 21:07:02 pm
Daarnaast is figuur 3 een model. Niet meer en niet minder. Dus gebaseerd op aannames (die dus lang niet allemaal waar hoeven te zijn) hoe iets zich in het verleden heeft afgespeeld.
Fig.3 is geen model, dat is eigenlijk rauwe data, weergegeven in een haplotype netwerk (iedere vogel heeft 1 mitochondriaal haplotype, een combinatie van allelen op het mtDNA). De voornaamste aanname hierin is de keuze van een mutatiemodel, maar dit zal hooguit minieme invloed op het resultaat uitoefenen, zeker bij een dergelijk simpel netwerk. Alleen bij de interpretatie van zo'n netwerk, komen dingen als refugia en mutatie snelheden om de hoek kijken, maar alleen als je hier conclusies over wilt trekken. In dit stuk is dat uberhaupt niet gebeurd. Met de initiele identificaties zou het netwerk er alleen anders uitzien in de zin dat de taxa minder unieke haplotypes (cirkels met 1 type invulling) zouden hebben, vrnl. fabalis en rossicus zouden dan meer haplotypes delen.
Goed, dus figuur 3 is geen model.
 
In principe laat de data hoe dan ook zien zien dat er weinig divergentie (in mtDNA) is binnen dit cluster rietganzen (bedenk dat het gebruikte mtDNA veruit het meest variabele stuk is) en er ook geen sprake is van structuur (er is geen initiele splitsing in een taiga clade en een toendra clade).
Citaat
Eens kijken of ik het nu snap: het gaat om bootstrap waardes >80% EN Bayesiaanse posterior probabilities > 95%?
Niet echt, een Baysian analyse geeft pp en een Maximum Parsimony bootstrap. Maximum Parsimony raakt een beetje uit de gratie aangezien het een beetje een te simplistisch beeld van sequence evolution geeft. Ik hecht meer waarde aan Bayesian (of Maximum Likelihood, wat wel weer veters aantrekken betekent).

Dus figuur 2 is wel een model? Het gaat mij een beetje boven de pet, dat gegoochel met 1000 maal ofzo een berekening uitvoeren, een Baysian analyse, een Maximum Parsimony bootstrap etc, maar uiteindelijk zijn zowel figuur 2 als figuur 3 toch gewoon een model? Dus wat anders dan bv een figuur met de frequentieverdeling van de tarsuslengte van 100 adulte mannelijke Brandganzen?
 
Of begrijp ik er gewoon nix van?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 08, 2010, 21:15:36 pm
Je zou het een fylogenetische hypothese kunnen noemen. (Figuur 2 en 3 geven eigenlijk een beetje hetzelfde weer.)
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 08, 2010, 22:38:24 pm
Waarom zijn deze Sovon-aantallen niet genoemd en vervolgens verworpen als 'niet betrouwbaar' o.i.d.? Vergeten? Of speelden pettenproblemen? Of hanteert Sovon andere provinciegrenzen dan de Avifauna van Limburg? Of staan er fouten in de database van Sovon? Of weet jij een betere verklaring?
Alles zou kunnen. Ik heb het nagekeken, volgens de SOVON-website (zie: http://www.sovon.nl/default.asp?id=220 (http://www.sovon.nl/default.asp?id=220)) wordt met provinciegrenzen gewerkt bij de zwanen- en ganzentellingen. Dus het verschil kan niet veroorzaakt zijn door een verschillende definitie van "Limburg" (met dien verstande dat de Maas valt onder het gebied "Grote rivieren"). Eigenlijk zou in het boek hebben moeten staan waarom men de aantallen die in het SOVON-rapport staan genoemd terzijde heeft gelegd. Dat is al dan niet bewust niet gebeurd. Waarom weet ik ook niet.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 08, 2010, 23:01:17 pm
Je zou het een fylogenetische hypothese kunnen noemen. (Figuur 2 en 3 geven eigenlijk een beetje hetzelfde weer.)
Ben, bedankt hiervoor. Zoiets noem ik een model (of een idee). Doet me wel wat denken aan de getallen die uit overlevingsanalyses komen.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 09, 2010, 09:26:50 am
In principe laat de data hoe dan ook zien zien dat er weinig divergentie (in mtDNA) is binnen dit cluster rietgansen (bedenk dat het gebruikte mtDNA veruit het meest variabele stuk is) en er ook geen sprake is van structuur (er is geen initiele splitsing in een taiga clade en een toendra clade).

Waaraan kun je eigenlijk zien dat er weinig divergentie is? De lengte van de takken?

Niet echt, een Baysian analyse geeft pp en een Maximum Parsimony bootstrap. Maximum Parsimony raakt een beetje uit de gratie aangezien het een beetje een te simplistisch beeld van sequence evolution geeft. Ik hecht meer waarde aan Bayesian (of Maximum Likelihood, wat wel weer veters aantrekken betekend).

Ik weet het verschil wel, maar had even de indruk dat de vuistregel was 80% EN 95%. Als we uitgaan van de Bayesian pp, is het dan terecht om te denken dat er zelfs iets meer verschil lijkt te zijn tussen fabalis en rossicus (pp=99%) dan tussen middendorffii en de rest (pp=95%) of is dat al te simplistisch geredeneerd (vermoedelijk wel).

Citaat
Mooi hoe hier op twee niveaus (taxonomisch & ID) door elkaar wordtgepraat. Ik me voorstellen dat bij veel waarnemingen toch de vraag naarde geografische afkomst en variatie zal blijven bestaan. Wat we sowiesoniet moeten vergeten is om gewoon zo zorgvuldig mogelijk te blijvenregisteren.

Je zou zelfs kunnen zeggen dat er nog een 3e niveau is, nl. de sociologische/psychologische aspecten. De vraag is natuurlijk hoe het kan dat de getallen van Leo vd Bergh nu zo openlijk in twijfel wordt getrokken, terwijl hij een aantal jaren geleden nog meeschreef aan publicaties als:

Bergh L.M.J. van den 1999. Tundra Bean Goose Anser fabalis rossicus in: J.Madsen, G.Cracknell & A.D.Fox (eds). Goose Populations of the Western Palearctic. Wetlands International Publication No. 48. Wageningen / Rřnde.

Nilsson L, L.M.J.van den Bergh & J.Madsen 1999. Taiga Bean Goose in: J.Madsen, G.Cracknell & A.D.Fox (eds). Goose Populations of the Western Palearctic. Wetlands International Publication No.48. Wageningen/ Rřnde.

Daarmee neem ik overigens geen standpunt in over wie er gelijk heeft (weet ik ook echt niet), maar opmerkelijk is het toch wel.

Lützen

Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 09, 2010, 09:33:04 am

Nu we toch zo'n beetje alle geintresseerden, op dit op topic bij elkaar hebben, wat hebben we hier dan voor vogel....  Het was een grote vooral opvallende vogel (5 februari bij Langenboom).

Zie de mail van Albert voor een link, naar de foto op de Dutch Birding site.

Hoi Justin,

Elkaar foto's bespreken is misschien inderdaad wel de enige manier om vooruit te komen (zoals Albert ook al terecht aangaf), maar blijft zonder het ontbreken van een gouden standaard al snel steken in speculaties ben ik bang. Ga het toch proberen, maar wordt iets voor later.

Lützen
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 09, 2010, 10:41:38 am
Wat vermoedelijk nog niet veel mensen weten is dat sinds kort de ring- en terugmeldgegevens van alle in Nederland geringde vogels online zijn te raadplegen, althans op kaart. Dat geeft de mogelijkheid om bijvoorbeeld bij de "rietgans" te kijken wat er aan gegevens voorhanden is. Dat kan via de site www.griel.nl (http://www.griel.nl).
 
Op het eerste scherm staat links een veld "Toon soortkaarten". Daar moet je het veld "individuele soorten" aanklikken en bij soort "rietgans", "taigarietgans" of "toendrarietgans" invullen. Bij het gebied "world" en bij periode bijvoorbeeld "1-1-1954" tot "9-2-2010" (1954 is het jaar waarin met ringen van ganzen werd begonnen). De site is op mijn computer ontzettend langzaam, dus het kan even duren voor een scherm geladen is.
 
Tot vrij recent werden alle gevangen "rietganzen" als "rietgans" ingevoerd in het systeem van het Vogeltrekstation. Het invullen van Taigarietgans en Toendrarietgans levert alleen terugmeldingen op in Nederland en directe omgeving (afgezien van 1 terugmelding van een Taigarietgans in Noord-Noorwegen). Bij het invullen van "rietgans" krijg je alle terugmeldingen van alle "rietganzen" te zien. Het blijkt dan dat alle terugmeldingen westelijk van de rivier de Yenisey liggen, dus niet uit de gebieden waar A.(f). middendorffii en A.f/s.serrirostris broeden.
 
Nu zou je kunnen zeggen dat dat komt omdat daar zo weinig mensen wonen dat de kans op een terugmelding van een geringde vogel daar heel laag is. Daarom ook even bij 2 andere soorten gekeken waar veel op gejaagd wordt en die vrij oostelijk voorkomen, namelijk de Kolgans en de Smient. Van de Kolgans zijn in Nederland circa 45000 exemplaren geringd. Daarvan zijn er 32 teruggemeld ten oosten van de Yenisey, merendeels op Taymir. Van de Smient zijn in Nederland circa 28000 exemplaren geringd. Daarvan zijn er 7 teruggemeld ten oosten van de Yenisey. Uit die dun bevolkte gebieden komen dus wel tientallen terugmeldingen van Kolgans en Smient, maar niet van "rietganzen". Een aanwijzing dat uit dat gebied dus geen noemenswaardige aantallen "rietganzen" naar Nederland/Europa komen.
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 09, 2010, 10:53:54 am
Ik hoopte dat jij de tabel nog even ging doorspitten om te zien of er een patroon in de gesamplede dieren en haplotypen zat.
Goed.
 
Eerst maar eens een lijst van alles van de regio Nova Zembla, Vaygach & het Yugorski schiereiland (ligt naast elkaar en is allemaal toendra).
 
FAB1 Nova Zembla 16 juli 2002 (adult met maten, niet in slagpenrui)
FAB6 Nova Zembla 24 juli 1907 (adult met maten, niet in slagpenrui)
SER1 Nova Zembla 24 mei 1903 (adult met maten, niet in slagpenrui)
SER1 Nova Zembla dag/maand/jaar onbekend (geen maten, leeftijd onbekend, museum Moskou)
ROS2 Nova Zembla 4 aug 1997 (adult met maten, geen vleugellengte, kennelijk dus in slagpenrui)
ROS2 Nova Zembla 18 aug 1903 (adult met maten, niet in slagpenrui)
 
Dus van Nova Zembla al 3 taxa verzameld. Dus FAB vogels (=fabalis) op de toendra in Nova Zembla. En het is daar echt dikke toendra hoor (deels zelfs polar desert). En volgens GE zeker 1500 km ten westen van het meest dichtbijzijnde broedgebied van serrirostris (volgens kaart op pag 555 van Ruokonen). Van de ene SER is ongeveer niets bekend, de andere SER is >100 jaar geleden verzameld.
 
SER1 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
ROS2 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
ROS2 Vaygach dag/maand onbekend 1997 (geen leeftijd, geen maten, geen museumvogel).
 
Nou, dat is ook grondig gedocumenteerd allemaal....... En ook Vaygach (een eiland net onder Nova Zembla) ligt zeker 1500 km ten westen van het meest dichtbijzijnde broedgebied van serrirostris.
En dat het aangrenzende schiereiland Yugorski.
 
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
SER1 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
ROS2 Yugorski peninsula juni 2000 (geen dag, geen leeftijd, geen maten, geen museumvogel).
 
Ook dus maar 'matig' gedocumenteerd. Wellicht iets dichter bij (minder dan 1500 km) bij het meest dichtbijzijnde broedgebied van serrirostris? Maar de SER vogels zijn in ieder geval niet >100 jaar geleden verzameld, dus ideeën over veranderingen van broedgebieden in de loop van de tijd (door global warming of whatever) kun je naar het rijk der fabelen verwijzen?
 
Wel grappig / vreemd / verontrustend dat er dus 6 serrirostris monsters uit dit gebied komen (en dan ook nog eens zowel uit Nova Zembla, Vaygach als van het Yugorski schiereiland). Je zou deze regio, gezien de kaart op pag 555 toch echt karakteriseren als het kerngebied van rossicus. Wel allemaal van het haplotype SER1. Hoe zeker is eigenlijk dat haplotype SER1 behoort tot het taxon serrirostris? Of is dat gewoon een aanname?
 
En dan is er ook nog de geheimzinnige ROS4 vogel. Verzameld op 12 mei 1959 in 'Krasnojarsk' (maar waar ergens?) als adult (museumvogel, alle maten genomen) die '(...) based on mtDNA was placed into the rossicus group (the sole carrier of ROS4 haplotype).' Qua maten etc. nergens thuis te brengen volgens de tekst (maar geen wonder als er veel overlap is), maar dus een rossicus. Hoe zeker? Waarom hoort dit haplotype niet ergens anders bij? Of is het een kruising / hybride of whatever?
 
Ben benieuwd wat je & anderen hiervan vinden.
 
Een patroon lijkt er nauwelijks te zijn. Nou ja, terug naar de 'good old' Rietgans Anser fabalis? En/of concluderen dat er zowel in het veld als in het lab vaak niet uit is te komen (wat dus goed pleit voor één soort)? Waarom zijn vogelclubjes in allerlei landen (& ook internationale groepen) eigenlijk nooit meegegaan met George Sangster c.s. om Rietgans te splitsen in Toendrarietgans / Taigarietgans?
 
Groetjes, Klaas
Klaas, erg bedankt voor dit overzicht. De enige conclusie die (ook) ik hier uit kan trekken is dat de FAB, SER en ROS haplotypes gemengd voorkomen binnen populaties (locaties) en dat er dus weinig genetische ondersteuning is om deze vormen uberhaupt als taxa, laat staan soorten, te erkennen.


Vaag hoe ze dat haplotype netwerk er nog wel zo netjes uit weten te laten zien door twijfelachtige herdeterminaties, erg misleidend. Het enige alternatief zou zijn dat FAB, SER en ROS op plekken zoals het Kola Peninsula naast elkaar voorkomen zonder te mengen, maar dit is verder niet ondersteund en lijkt een brug te ver.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 09, 2010, 11:03:41 am
Wel grappig / vreemd / verontrustend dat er dus 6 serrirostris monsters uit dit gebied komen (en dan ook nog eens zowel uit Nova Zembla, Vaygach als van het Yugorski schiereiland). Je zou deze regio, gezien de kaart op pag 555 toch echt karakteriseren als het kerngebied van rossicus. Wel allemaal van het haplotype SER1. Hoe zeker is eigenlijk dat haplotype SER1 behoort tot het taxon serrirostris? Of is dat gewoon een aanname? En dan is er ook nog de geheimzinnige ROS4 vogel. Verzameld op 12 mei 1959 in 'Krasnojarsk' (maar waar ergens?) als adult (museumvogel, alle maten genomen) die '(...) based on mtDNA was placed into the rossicus group (the sole carrier of ROS4 haplotype).' Qua maten etc. nergens thuis te brengen volgens de tekst (maar geen wonder als er veel overlap is), maar dus een rossicus. Hoe zeker? Waarom hoort dit haplotype niet ergens anders bij? Of is het een kruising / hybride of whatever?
Ik denk dat we in de eerste plaats niet te veel aan de namen die ze aan de haplotypen hebben meegegeven moeten hangen!
Wat is het dan? En wat betekent de mistige zin 'One of the haplotypes (SER1) was shared by rossicus and serrirostris.'? Dus waar hebben Ruokonen et al het dan eigenlijk over? En op grond van wat voor criteria krijgen de ?25 of ?30 of ?18 verschillende haplotypen de naam 'FAB', 'SER', 'ROS', 'MID' etc dan opgeplakt? Eerlijk gezegd begint het mij wat te duizelen hoor.
 
Daarnaast stond in de inleiding van Ruokonen ea een intrigerende zin. 'According to Delacour (1951), the taiga- and tundra-breeding Bean Geese intermingle in northern Russia between the Kanin Peninsula and the Khatangha River.' Het artikel van Delacour is natuurlijk al stokoud, maar is wel al gedigitaliseerd (zie bijlage). Delacour was een 'lumper', maar het gaat me nogal om een gebied!
 
"In the two extreme parts of the range of the species, Forest and Tundra Bean Geese are always keeping quite distinct, but they mingle in northern Russia, between the Kanin Peninsula and the Urals, and further east up to the Khatanga River in Siberia, where mixed populations occur. To add to difficulties, many Forest Geese move north into the tundra during the summer to molt, particularly in Nova Zembla, and they have easily been mistaken for local breeding birds."
 
En met een mooi kaartje op pagina 137. Gaat snel om een gebied met een lengte van >2000 km (bron GE). En er komen ook wel een heleboel terugmeldingen van in Nederland geringde Rietganzen vandaan (zie kaartjes op http://www.geese.org/Ganzen/Index.jsp (http://www.geese.org/Ganzen/Index.jsp)). Misschien ook het gebied waar de Rietganzen vandaan komen waar niet / moeizaam een naam (Toendrarietgans of Taigarietgans) op is te plakken?

Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 09, 2010, 11:15:27 am
Klaas, erg bedankt voor dit overzicht. De enige conclusie die (ook) ik hier uit kan trekken is dat de FAB, SER en ROS haplotypes gemengd voorkomen binnen populaties (locaties) en dat er dus weinig genetische ondersteuning is om deze vormen uberhaupt als taxa, laat staan soorten, te erkennen. Vaag hoe ze dat haplotype netwerk er nog wel zo netjes uit weten te laten zien door twijfelachtige herdeterminaties, erg misleidend. Het enige alternatief zou zijn dat FAB, SER en ROS op plekken zoals het Kola Peninsula naast elkaar voorkomen zonder te mengen, maar dit is verder niet ondersteund en lijkt een brug te ver.
hoi Jelmer,
Bedankt voor je reactie. Ik zie als belangrijkste probleem dat Ruokonen ea vreselijk aan het 'rotzooien' zijn geweest met de definitie 'broedvogel' / 'broedpopulaties.' Want echt diverse malen in het artikel wordt toch keihard beweerd dat ze monsters hebben verzameld van broedvogels, onderzoek willen gaan doen aan broedvogels, etc.
 
Eerder heb ik al een aantal citaten gegeven. Een andere citaat op pagina 556 (rechterkolom): 'Mantel test was performed in TFPGA separately for birds breeding in tundra and taiga'. Nu heb ik geen flauw vermoeden wat een 'mantel test' is, noch wat TFPGA is, maar ik weet wel wat een broedvogel is en wat wordt verstaan onder Rietganzen die op de toendra of in de taiga broeden. Dat zijn geen vage begrippen. Jij & ik weten ook wat wordt verstaan onder Grauwe Ganzen die in Nederland broeden. Horen daar dan ook de ruiers uit de OVP bij? En GG's die in augustus in Noord-Nederland door plezierjagers zijn neergeknald?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: HPM op februari 09, 2010, 11:15:41 am
Wat vermoedelijk nog niet veel mensen weten is dat sinds kort de ring- en terugmeldgegevens van alle in Nederland geringde vogels online zijn te raadplegen, althans op kaart. Dat geeft de mogelijkheid om bijvoorbeeld bij de "rietgans" te kijken wat er aan gegevens voorhanden is. Dat kan via de site www.griel.nl (http://www.griel.nl).
 
Op het eerste scherm staat links een veld "Toon soortkaarten". Daar moet je het veld "individuele soorten" aanklikken en bij soort "rietgans", "taigarietgans" of "toendrarietgans" invullen. Bij het gebied "world" en bij periode bijvoorbeeld "1-1-1954" tot "9-2-2010" (1954 is het jaar waarin met ringen van ganzen werd begonnen). De site is op mijn computer ontzettend langzaam, dus het kan even duren voor een scherm geladen is.
 ...

Voor het gemak hier een kaartje uit Griel waar het meeste op staat.

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 09, 2010, 12:00:33 pm
"In the two extreme parts of the range of the species, Forest and Tundra Bean Geese are always keeping quite distinct, but they mingle in northern Russia, between the Kanin Peninsula and the Urals, and further east up to the Khatanga River in Siberia, where mixed populations occur. To add to difficulties, many Forest Geese move north into the tundra during the summer to molt, particularly in Nova Zembla, and they have easily been mistaken for local breeding birds."

Hmm, dat maakt het wel heel lastig en je zou dan optimistisch kunnen zijn en veronderstellen dat de co-inhabitatie van bepaalde gebieden in Noord-Rusland door dit soort ruitrek verklaard kan worden. Ben zelf wel wat skeptisch en heb zo'n vermoeden dat die mixed populations inderdaad bestaan. We need more data!
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 09, 2010, 12:14:21 pm
Je zou zelfs kunnen zeggen dat er nog een 3e niveau is, nl. de sociologische/psychologische aspecten. De vraag is natuurlijk hoe het kan dat de getallen van Leo vd Bergh nu zo openlijk in twijfel wordt getrokken, terwijl hij een aantal jaren geleden nog meeschreef aan publicaties als:
Bergh L.M.J. van den 1999. Tundra Bean Goose Anser fabalis rossicus in: J.Madsen, G.Cracknell & A.D.Fox (eds). Goose Populations of the Western Palearctic. Wetlands International Publication No. 48. Wageningen / Rřnde.
Nilsson L, L.M.J.van den Bergh & J.Madsen 1999. Taiga Bean Goose in: J.Madsen, G.Cracknell & A.D.Fox (eds). Goose Populations of the Western Palearctic. Wetlands International Publication No.48. Wageningen/ Rřnde.
Daarmee neem ik overigens geen standpunt in over wie er gelijk heeft (weet ik ook echt niet), maar opmerkelijk is het toch wel. Lützen
hoi Lützen,
 
Ik weet ook niet wie gelijk heeft hoor. Maar het allemaal wel erg opvallend / vreemd. Vergeet ook niet dat Leo van den Bergh (via de ietwat cryptische auteur 'Sovon ganzen- & zwanenwerkgroep') ook één van de auteurs is van de jaarlijkse wavo-rapporten van Sovon (in ieder geval van de rapporten van 2000/01 t/m 2006/07, de meest recente die in 2008 is gepubliceerd).
 
En ik begrijp er ook helemaal niets van dat een auteur in de ene publicatie (namelijk de Avifauna van Limburg, zie hierboven voor de citaten) beweert dat er na de milleniumwisseling nauwelijks nog Taigarietganzen in Limburg voorkomen en in een andere publicatie (wavo-rapport 2002/03) stelt dat er in februari 2003 in totaal 933 Taigarietganzen in Limburg zaten. En dat terwijl het wavo-rapport 2002/03 gewoon in de literatuurlijst staat van de Avifauna van Limburg en er bij de soortsbespreking van Taigarietgans niet naar wordt verwezen.
 
Enig idee?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 09, 2010, 13:04:06 pm
Citaat
Citaat van: Triturus op februari 08, 2010, 20:26:55 pm (http://forum.waarneming.nl/smf/index.php?topic=99209.msg675628.html#msg675628)<blockquote>Inprincipe laat de data hoe dan ook zien zien dat er weinig divergentie(in mtDNA) is binnen dit cluster rietgansen (bedenk dat het gebruiktemtDNA veruit het meest variabele stuk is) en er ook geen sprake is vanstructuur (er is geen initiele splitsing in een taiga clade en eentoendra clade).

</blockquote>
Waaraan kun je eigenlijk zien dat er weinig divergentie is? De lengte van de takken?

Citaat van: Triturus op februari 08, 2010, 20:26:55 pm (http://forum.waarneming.nl/smf/index.php?topic=99209.msg675628.html#msg675628)<blockquote>Nietecht, een Baysian analyse geeft pp en een Maximum Parsimony bootstrap.Maximum Parsimony raakt een beetje uit de gratie aangezien het eenbeetje een te simplistisch beeld van sequence evolution geeft. Ik hechtmeer waarde aan Bayesian (of Maximum Likelihood, wat wel weer vetersaantrekken betekend).

</blockquote>
Ikweet het verschil wel, maar had even de indruk dat de vuistregel was80% EN 95%. Als we uitgaan van de Bayesian pp, is het dan terecht om tedenken dat er zelfs iets meer verschil lijkt te zijn tussen fabalis enrossicus (pp=99%) dan tussen middendorffii en de rest (pp=95%) of isdat al te simplistisch geredeneerd (vermoedelijk wel).

Inderdaad, de taklengteis een maat voor divergentie ja. Fig3 laat hier niets van zien, wat ik raarvind (meestal wordt aantal mutaties aangegeven per takje. Fig2 wel. Er staateen scale bar onder die het aantal mutaties weer geeft. 0.001 per site is 0.1%is 10 mutaties per 1000 baseparen. Dat lijkt nog aardig wat, maar decontrolregion is gedeeltelijk hypervariabel (wat niet altijd handig is voorphylogenetische reconstructie).

De waarden terondersteuning slaan op de clusters die volgen op het takje waarboven diewaarden staan. Alleen 95% of hoger wordt als voldoende ondersteuningaangenomen. Dus het cluster MID1 en MID5 heeft een ondersteuning van 100% en dedrie FAB worden ook in 100% van de gesampelde bomen aangetroffen. Voor SER plusROS cluster is dat slechts in 83%, voor ROS slechts 87% en voor SER minder dan50%. Al deze takken zou je eigenlijk moeten collapsen en dan krijg je eenpolytomy met 5 basale lineages in het FAB,SER,ROS complex. Rietganzen samen is95% ( je zou liever honderd hebben, maar ach). Kleine Riet 100%. Kleine Riet enRiet 97%, wat dus betekend dat in een deel van de gesampelde bomen Kol ofGrauwe er ergens tussen clustert. Dat is raar, aangezien die toch echt welflink verschillen (takken zijn ingekort weergegeven). Dan vraag ik me af of zewel alleen in een optimum in tree space hebben gesampeld en niet watbaggerbomen hebben meegenomen…

Het zou overigenseen stuk minder misleidend zijn als je de labels van de haplotypen gewoon zou vervangen door nummers. Dan krijg je ook niet het beeld dat FAB echt taiga'szijn enzo. Dat lijkt toch niet het geval. Jelmer lijkt ook echt te denken datin Juli gesampelde beesten van Nova Zembla broeders moeten zijn? De satellietgevolgde ganzen, wanneer waren die daar aangekomen? Ruiende beesten zo vroeg inhet jaar, zelfs als een broedsel mislukt zou zijn, is dat een optie. Je bentdan wel erg veel uitzonderingen toe aan het laten.

Grappig inderdaadhoe al die aspecten bij die rietganzen naar boven komen en dat het allemaaldoor elkaar loopt, niet alleen in dit topic maar ook in andere. Wel watchaotisch maar ach!
Titel: Re: rietgans, again...
Bericht door: jelmerpoelstra op februari 09, 2010, 14:08:45 pm
Jelmer lijkt ook echt te denken datin Juli gesampelde beesten van Nova Zembla broeders moeten zijn?


Wat bedoel je precies? Hoe dan ook ben ik het met je eens -- de optie dat deze indiv. ruitrekkers zouden kunnen zijn is een manier om het samen voorkomen evt 'goed te praten', maar dit lijkt niet bepaald logisch.
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op februari 09, 2010, 14:15:53 pm
Nee omdat je de optie van de FAB, SER, ROS meuk binnen een Nova Zembla broedpopulatie het waarschijnlijkst vindt. De FAB beesten zijn in juli gesampelt en ik vroeg me af hoe groot jullie de kans achten dat het eventueel ruitrekkers betreft. Wanneer zou je de eerste ruitrekkers kunnen verwachten?
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 09, 2010, 18:12:05 pm
(http://waarneming.nl/fotonew/3/1053503.jpg)(http://waarneming.nl/fotonew/2/1053502.jpg)

Zo simpel is het eigenlijk......
Titel: Re: rietgans, again...
Bericht door: Muad'Dib op februari 09, 2010, 19:40:09 pm
Hierbij nog een plaat die de discussie verder kan helpen...?


Ik geniet hiervan... :duim:


Overigens iemand die weet uit welk boek dit komt? Kan me zo voorstellen dat de tekst ook leuk is...
Titel: Re: rietgans, again...
Bericht door: marijn op februari 09, 2010, 20:15:25 pm
Zo simpel is het eigenlijk......

Schitterende plaat! Waar komt dit vandaan en van wanneer?
Nu is ook meteen duidelijk waar de naam serrirostris vandaan komt (zaagsnavel)...
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 09, 2010, 20:46:56 pm
Zo simpel is het eigenlijk......

Schitterende plaat! Waar komt dit vandaan en van wanneer?
Nu is ook meteen duidelijk waar de naam serrirostris vandaan komt (zaagsnavel)...
Komt uit de lade van het Brits Museum waar de rietganzen in liggen. Is getekend door Oates in 1905.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 09, 2010, 21:22:56 pm
Hierbij nog een plaat die de discussie verder kan helpen...? Ik geniet hiervan. Overigens iemand die weet uit welk boek dit komt? Kan me zo voorstellen dat de tekst ook leuk is.
hoi Dirk,
Het lijkt dat deze tekeningen gemaakt zijn door Peter Scott in 1952? Wellicht uit J. Delacour 1954. The waterfowl of the world, deel 1. Londen?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: HPM op februari 09, 2010, 21:51:58 pm
Zo simpel is het eigenlijk......

Schitterende plaat! Waar komt dit vandaan en van wanneer?
Nu is ook meteen duidelijk waar de naam serrirostris vandaan komt (zaagsnavel)...
Komt uit de lade van het Brits Museum waar de rietganzen in liggen. Is getekend door Oates in 1905.
Ik denk dat het dit moet zijn:
 Oates, E. W,- On the species of Bean-geese. Bombay, J. Nat. Hist. Soc.. 1906 (38-50, 1 pi.).
Heb ik niet online kunnen vinden, wel dit:
 Sergius Alphéraky (1906) A few words in reply to Mr. E.W. Oates' paper on the species of bean-geese

http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 09, 2010, 22:23:05 pm
wel dit:  Sergius Alphéraky (1906) A few words in reply to Mr. E.W. Oates' paper on the species of bean-geese http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up (http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up)
Wat een vondst! Toen (> 100 jaar geleden) had men dus ook al dikke ruzie over Rietganzen. 'It is better to wait for what mr Buturlin has to tell us about the bird from personal observation, than to continue to discuss the question over only a few dry skins at our proposal.' Maar geweldig om het te lezen!
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 09, 2010, 23:32:04 pm
wel dit:  Sergius Alphéraky (1906) A few words in reply to Mr. E.W. Oates' paper on the species of bean-geese http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up (http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up)
Wat een vondst! Toen (> 100 jaar geleden) had men dus ook al dikke ruzie over Rietganzen. 'It is better to wait for what mr Buturlin has to tell us about the bird from personal observation, than to continue to discuss the question over only a few dry skins at our proposal.' Maar geweldig om het te lezen!
Inderdaad, honderd jaar zijn we nu verder en we snappen het nog steeds niet.
Titel: Re: rietgans, again...
Bericht door: marijn op februari 09, 2010, 23:34:25 pm
Ornithologische polemiek van meer dan een eeuw (!) geleden, en zo leesbaar, fantastisch!
Titel: Re: rietgans, again...
Bericht door: RWester op februari 10, 2010, 03:03:53 am
Nog een groot en geelsnavelige duit in het rietganszakje
 
http://nijmegen.waarneming.nl/foto/view/1035905 (http://nijmegen.waarneming.nl/foto/view/1035905)
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op februari 10, 2010, 07:08:52 am
Remco,
 
Deze vogel is via Justin en mij al meerdere malen langs gekomen in dit topic (en via mijn mail met een groepje wat nog naast dit forum participeert). Veel mensen (net als ik, heb de vogel ook gezien en Justin heeft nog betere foto's) gaan voor Taiga (geelbek) toen ik er was leken er ook +/- 3 (zwartbekken) aanwezig in een groepje van verder Toendra's. Niet iedereen was even zeker van Taiga overigens, de critici vonden de snavelvorm iets minder typisch.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 10, 2010, 07:55:26 am
wel dit:  Sergius Alphéraky (1906) A few words in reply to Mr. E.W. Oates' paper on the species of bean-geese http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up (http://www.archive.org/stream/afewwordsinrepl00alphgoog#page/n3/mode/1up)
Wat een vondst! Toen (> 100 jaar geleden) had men dus ook al dikke ruzie over Rietganzen. 'It is better to wait for what mr Buturlin has to tell us about the bird from personal observation, than to continue to discuss the question over only a few dry skins at our proposal.' Maar geweldig om het te lezen!
Buturlin kwam overigens dus met rossicus op de proppen.....
Titel: Re: rietgans, again...
Bericht door: Muad'Dib op februari 10, 2010, 13:34:42 pm
Vandaag in heerlijke sneeuwbuien een paar duizend Rietganzen in Drenthe bekeken. 99,999% is m.i. Toendra. Volgens mij had ik twee Taiga's, Tenminste als ik af mag gaan op Oates en zijn getekende snavels. Volgens mij vallen deze twee onder "arvensis"...





Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 10, 2010, 16:04:31 pm
Vandaag in heerlijke sneeuwbuien een paar duizend Rietganzen in Drenthe bekeken. 99,999% is m.i. Toendra. Volgens mij had ik twee Taiga's, Tenminste als ik af mag gaan op Oates en zijn getekende snavels. Volgens mij vallen deze twee onder "arvensis"...
moi Dirk,
 
Mooie foto's zeg! Akkergans (Anser arvensis) is eigenlijk een veel betere naam voor Rietgans. Ooit een Rietgans in het riet zien zitten? Leo van den Bergh vindt de naam Rietgans ook maar nix. En ik ben heel benieuwd wat de deskundigen zeggen van deze vogels. Ga vooral door met het maken van dit soort foto's. En jij woont ook nog eens in het goede gebied! Staat Taigarietgans trouwens (nog?) op je lijst?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Muad'Dib op februari 10, 2010, 16:22:28 pm
Hoi Klaas,


Ja de Taiga staat sinds 1997 op mijn lijst (een groepje knoeperds bij Roden). En je hebt gelijk ik woon in het goede gebied, maar zie bijna nooit Taiga's, ondanks vele claims (zie oa Lauwersmeer.com) in dit gebied. Vandaag heb ik heel precies alle zitten blijvende groepen doorgespit (ze waren erg vliegerig). Resultaat; deze twee geelbekken, veel geelsnavelige Toendra's en heel veel rechtdoorzee Toendra's. Het viel mij op dat er vrij veel verschil in formaat zit in de Rietganzen, van iets groter dan Kolgans, tot bijna formaat Grauwe gans. Verschil in neklengte is me nauwelijks opgevallen.


Ook nog een geringde Toendra (gele halsband; ACY). Kon het project op colourrings niet vinden en geese.org geeft geen ringgegevens beschikbaar...


Dit weekend maar weer eens kijken...


Groet
Titel: Re: rietgans, again...
Bericht door: Jeddah op februari 10, 2010, 20:05:25 pm
Hoi!

Ik meld me even als een van de waarnemers die Taigarietgans heeft ingevoerd.
Mijn beide waarnemingen staan san ook nog op "nog niet te beoordelen" en naar aanleiding daarvan ging ik hier op het forum zoeken.

Ik ben een beginner en kan zo'n 3/4 van jullie gesprek totaal niet volgen  :rolleye: maar dat geeft niet, ik leer wel.

Mijn vraag is of ik nog kan helpen met foto's of informatie betreft mijn waarnemingen?
http://waarneming.nl/waarneming/view/46196445
http://waarneming.nl/waarneming/view/46315816

Het was in beide gevallen niet mogelijk veel dichterbij te komen en is mijn zoom helaas niet toerijkend geweest.

En dan terwijl ik hier toch ben, vanmiddag een enorme groep ganzen waargenomen, zoveel heb ik er nooit samen gezien. Was onwijs gaaf om mee te maken, ze kwamen in kleine groepen aanvliegen.
Enig idee welk soort? Het sneeuwde flink dus de foto's zijn erg moeilijk te beoordelen ik heb ze bewerkt zodat hopelijk wle voldoende te zien is.
(http://pic20.picturetrail.com/VOL66/846824/15017613/382565208.jpg)

(http://pic20.picturetrail.com/VOL66/846824/15017613/382565192.jpg)

Om een indruk te krijgen van de groote van de groep:
(http://94.100.118.171/868700001-868750000/868740001-868740100/868740002_6_aKax.jpeg)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 10, 2010, 20:23:35 pm
Hoi!

Ik meld me even als een van de waarnemers die Taigarietgans heeft ingevoerd.
Mijn beide waarnemingen staan san ook nog op "nog niet te beoordelen" en naar aanleiding daarvan ging ik hier op het forum zoeken.

http://waarneming.nl/waarneming/view/46196445 (http://waarneming.nl/waarneming/view/46196445)


Te beoordelen is de regel bij alle taigarietgans waarnemingen, zolang er nog geen definitief artikel is verschenen hoe deze vogels te herkennen. Op jouw tweede foto, staat linksachter wel een mogelijke Taigarietgans.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 10, 2010, 21:15:42 pm
Hoi Klaas, Ja de Taiga staat sinds 1997 op mijn lijst (een groepje knoeperds bij Roden). En je hebt gelijk ik woon in het goede gebied, maar zie bijna nooit Taiga's, ondanks vele claims (zie oa Lauwersmeer.com) in dit gebied. (..).  Ook nog een geringde Toendra (gele halsband; ACY). Kon het project op colourrings niet vinden en geese.org geeft geen ringgegevens beschikbaar. Dit weekend maar weer eens kijken. Groet
moi Dirk,
even gevraagd aan een aflezer. Die mailde me dat deze vogels net pas deze winter zijn geringd. "De letter cijfer cijfer combi's waren op en nu zijn ze overgestapt op letter letter letter. Ringgegevens zullen tzt wel op geese.org komen. Vogels zijn in Duitsland of Nederland gevangen."
 
Verder nog even in de boekenkast gekeken en een nieuwe scan gemaakt van een artikel van twee Drenten over de ontwikkelingen rond het Dwingelderveld e.o. in de afgelopen 50 jaar. Scan over 2 pdf's verdeeld; hier eerst deel 1.
 
Arend Jan van Dijk & Joop Kleine 2008. In vijftig jaar tijd steeds meer overwinterende ganzen in ZW-Drenthe. Drentse Vogels 22: 28-41.
 
Ook zij zien nog steeds flinke aantallen Taigarietganzen. De cruciale passage via knip/plak:
 
"Toendra- en Taigarietgans
In de jaren zestig en zeventig ging het waarschijnlijk in hoofdzaak om Taigarietganzen, althans twaalf dode of gewonde ganzen uit die periode waren alle Taiga's. Volgens steekproefberekeningen lag het gemiddelde percentage Taigarietganzen tot en met 1987/88 tussen de 65% en 100%, dat zakte in 1989-1998 naar 24-27% en in 1999-2008 naar 4-5% (bijlage 2). Omgerekend naar aantallen ligt het maximum aantal Taigarietganzen in ZW-Drenthe na 1975/76 jaarlijks tussen de 111 en 3568, gemiddeld 490 ex. Tussen 1978/79 en 1986/87 bereikten Taigarietganzen topaantallen. Het gemiddelde aantal lag toen op 1325 ex., vooral door toedoen van de winters 1978/79 (1794 ex.) en 1986/87 (3568 ex.).
Na 1986/87 loopt het gemiddelde aantal Taigarietganzen terug tot 279 , met alleen nog hoge aantallen in 1997/98 1176 ex.), 1.998/99 (668 ex.), 2003/04 (818 ex.) en 2005/06 (1051 ex.). De laagste aantallen Taigarietganzen zijn allemaal van na 1994/95 , juist in de periode met de enorme populatiegroei. De recente groei bij Rietganzen komt dus vrijwel geheel voor rekening van Toendrarietganzen, hetgeen ook elders in Drenthe het geval is (Venema 2001, van den Bergh 2004). Taigarietganzen worden het meest in de omgeving van het Dwingelderveld en in de Vledder Aa gezien en weinig bij Meppel. De indruk bestaat dat in de jaren zeventig het vrij stabiele aantal overwinterende rietganzen vooral Taigarietganzen waren en dat de piekaantallen in februari-maart veroorzaakt werden door doortrek van Toendrarietganzen."
------------------
Misschien heb jij dit artikel trouwens ook wel in de kast staan (geen idee of je ook donateur van de WAD bent). Kom jij ook wel eens in deze regionen?
-------------
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 10, 2010, 21:17:51 pm
Scan over 2 pdf's verdeeld; hier deel 2 van: Arend Jan van Dijk & Joop Kleine 2008. In vijftig jaar tijd steeds meer overwinterende ganzen in ZW-Drenthe. Drentse Vogels 22: 28-41.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 10, 2010, 22:34:47 pm
Resultaat; deze twee geelbekken, veel geelsnavelige Toendra's en heel veel rechtdoorzee Toendra's.

Even uit de heup, want ik moet andere dingen doen: Waarom denk je eigenlijk dat die vogel links op je eerste foto geen Taiga is? Lijkt me toch wel zo'n beetje hetzelfde soort snavel, al is ie wat minder geel. Heb je trouwens misschien ook nog wat fotootjes van een paar geelsnavelige Toendra's (en kun je inschatten hoeveel je er ziet per 100 of 1000 vogels)?

Lutzen
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op februari 10, 2010, 22:42:19 pm
Heb je trouwens misschien ook nog wat fotootjes van een paar geelsnavelige Toendra's?

Lutzen


Zoiets?  (2-2-2010 Oranje DR.)
 
Groet Edwin.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 10, 2010, 23:14:23 pm
Heb je trouwens misschien ook nog wat fotootjes van een paar geelsnavelige Toendra's?

Lutzen


Zoiets?  (2-2-2010 Oranje DR.)
 
Groet Edwin.

Mooi, maar hoe zeker ben je van je zaak?

http://www.hannuhuttu.com/gallery/albums/testi/10001/normal_2005_04_28%20372.jpg

Overigens is het niet mijn bedoeling alleen maar overal vraagtekens bij te zetten, dus ik ben toch wel benieuwd of jij een schatting kunt geven hoe vaak je dit soort vogels nu ziet per 100 of 1000 rietganzen en of dit varieert per groep en of je er wel eens meerdere bij elkaar ziet etc....

Lutzen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 11, 2010, 07:40:04 am
(http://waarneming.nl/fotonew/2/1051382.jpg)(http://waarneming.nl/fotonew/3/1051383.jpg)(http://waarneming.nl/fotonew/0/1051520.jpg)
 
Dit zijn gewoon drie voorbeeldjes van enkele vogels uit een groep Rietganzen zondag in Velp Noord (bij Grave). Ik zie oranjebekkige vogels regelmatig.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 11, 2010, 11:51:08 am
Ik ook hoor Justin, daarom kost het ook niet zoveel moeite een foto te maken waar er meerdere bij elkaar staan:

(http://waarneming.nl/fotonew/2/1055262.jpg)

In een groep van zo'n 400 rietganzen had ik daar 20-30 vrijwel volledig oranjesnavelige ganzen. Meeste vogels van het formaat Kolgans+, dus zeker geen kanjers en geen al te lange nekken. Wel redelijk wat vogels met vrij platte, niet uitgebogen, snavels:

(http://waarneming.nl/fotonew/8/1055258.jpg)

Heb het idee dat het aandeel oranjesnavelige vogels tussen groepen behoorlijk kan verschillen en ben eigenlijk wel benieuwd wat nu normaal is en of anderen dezelfde ervaring hebben. Meer vogels op:
http://waarneming.nl/waarneming/view/46353134 (http://waarneming.nl/waarneming/view/46353134)


Lützen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 11, 2010, 12:24:31 pm
Lutzen, is de onderste geen Kleine Rietgans? Bovendelen en pootkleur o.a.?
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 11, 2010, 13:13:58 pm
Lutzen, is de onderste geen Kleine Rietgans? Bovendelen en pootkleur o.a.?

Klopt helemaal, meeste rietganzen waren ongeveer dezelfde maat dus de gedachten gaan ook daarom al niet uit naar een groep Taigarietganzen. Blijf het wel een interessant fenomeen vinden.

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 11, 2010, 13:36:32 pm
http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek

en rechtstreeks:

http://waarnemingen.be/waarneming/view/46222497

 :rolleye:

Laat ik het maar opmerkelijk noemen.

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 11, 2010, 13:48:43 pm
Aan de andere kant, zitten er dus ook dit soort jongens tussen:

(http://waarneming.nl/fotonew/5/1055305.jpg)

Misschien iets groter dan de rest, maar niet veel. Vind zelf echter de gelijkenis met de (in mijn herinnering) wel iets meer opvallendere vogels van het Vlijmens Ven opmerkelijk:

(http://waarneming.nl/fotonew/3/1016223.jpg)

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 11, 2010, 14:08:31 pm

Nu we toch zo'n beetje alle geintresseerden, op dit op topic bij elkaar hebben, wat hebben we hier dan voor vogel....  Het was een grote vooral opvallende vogel (5 februari bij Langenboom).

Zie de mail van Albert voor een link, naar de foto op de Dutch Birding site.

Zolang er ook in Finland nog vogels met dit soort snavels rondvliegen denk ik dat het niet heel erg nuttig is om te speculeren over herkomst op basis van een enkel individu.

http://www.tarsiger.com/images/SL/peteruppstu_ansfab4.jpg

Ik vind de snavelbasis overigens wel opvallend hoog, maar hoe erg is dat? Verder doet de vogel me wel wat denken aan een combinatie van mogelijke Taiga's van Fred Hustings:
http://waarneming.nl/fotonew/1/1050451.jpg
http://waarneming.nl/fotonew/4/1015854.jpg

Groeten,

Lützen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 11, 2010, 21:01:17 pm
We hadden het al eerder over Kleine Rietgans, wat te denken van deze vogel; http://waarneming.nl/waarneming/view/46280234 heeft wel iets weg van de door Lutzen gefotografeerde vogel, met grote forse snavel.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 11, 2010, 22:10:42 pm
We hadden het al eerder over Kleine Rietgans, wat te denken van deze vogel; http://waarneming.nl/waarneming/view/46280234 (http://waarneming.nl/waarneming/view/46280234) heeft wel iets weg van de door Lutzen gefotografeerde vogel, met grote forse snavel.

Als ik zie hoe variabel de snavels van de in Norfolk overwinterende kleine rieten zijn, vind ik niets opvallend aan deze vogel. Zie: http://www.gobirding.eu/Photos/PinkfootedGoose.php (http://www.gobirding.eu/Photos/PinkfootedGoose.php)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 12, 2010, 06:35:00 am
We hadden het al eerder over Kleine Rietgans, wat te denken van deze vogel; http://waarneming.nl/waarneming/view/46280234 (http://waarneming.nl/waarneming/view/46280234) heeft wel iets weg van de door Lutzen gefotografeerde vogel, met grote forse snavel.

Als ik zie hoe variabel de snavels van de in Norfolk overwinterende kleine rieten zijn, vind ik niets opvallend aan deze vogel. Zie: http://www.gobirding.eu/Photos/PinkfootedGoose.php (http://www.gobirding.eu/Photos/PinkfootedGoose.php)
Dank was me ff niet bekend, dat snavels zo lang konden zijn, maar het kan dus! Top.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 12, 2010, 21:39:50 pm
Recente foto's van Taigarietganzen in Nederland staan bv ook op
http://www.dutchbirding.nl/galleryzoek.php?soort=8&plaats=&fotograaf=&datum=&zoek=Zoek+foto%27s (http://www.dutchbirding.nl/galleryzoek.php?soort=8&plaats=&fotograaf=&datum=&zoek=Zoek+foto%27s)
http://galerij.avifaunagroningen.nl/displayimage.php?pos=-10990 (http://galerij.avifaunagroningen.nl/displayimage.php?pos=-10990)
http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&landid=all (http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&landid=all)
http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=Taigarietgans&personal_album=1 (http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=Taigarietgans&personal_album=1)
http://www.birdpix.nl/album_search.php?search_type=pic_latin_name&search=Anser+fabalis&personal_album=1 (http://www.birdpix.nl/album_search.php?search_type=pic_latin_name&search=Anser+fabalis&personal_album=1)
Bij de laatste link oa ook een foto van een Nijlgans. Verder staan er foto's van Anser fabalis rossicus, Anser fabalis, Anser fabalis spec. en Anser serrirostris.
 
Benieuwd wat jullie hiervan vinden (deels staan de foto's ook op andere websites en/of worden ze hier vermeld). Het commentaar bij http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek) vond ik opmerkelijk. Determineer je Taigarietgans en Toendrarietgans op grond van de waarneemlocatie (= bv land)? Wat als de plaats (=Zweden) was weggelaten cq veranderd in Nederland?
 
In het verlengde hiervan:
* hoe zeker zijn alle determinaties van Toendrarietgans in Nederland?
* is een Rietgans (of 'rietgans', afhankelijke welke soortindeling je volgt) die niet kwalificeert voor Taigarietgans (johanseni / middendorffii etc. buiten beschouwing latend) dus automatisch voor 100% zeker een Toendrarietgans?
 
De afgelopen dagen ook nog eens even de artikelen van Leo van den Bergh in 'het Vogeljaar' gelezen. De volgende items bleven wat hangen:
* hanteren Sovon & Leo c.s. misschien andere criteria dan veel vogelaars die hier & in DB kringen actief zijn?
* Leo legt (m.i. terecht!) sterk de nadruk op gedrag, positie in de groep, familieverbanden etc. Dus gewoon langdurig kijken & vergelijken t.o.v. andere ganzen & dat alles in het veld. Veel van deze aspecten zijn (vaak) niet meer vast te stellen op een foto (en deze foto mist ook nog eens een dimensie).
* om hoeveel 'twijfelganzen' gaat het eigenlijk in Nederland? Tientallen, honderden, duizenden? Dus 'rietganzen' waarvan je niet met 100% zekerheid het label 'Toendrarietgans' kunt vastplakken, maar ook niet met 100% zekerheid het label 'Taigarietgans.'
 
* gaat de discussie vooral over deze 'twijfelganzen'?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 12, 2010, 22:13:44 pm
Hoi Klaas,
 
Ik heb al die foto's nog een keer bekeken en ik heb sterk het vermoeden dat het overgrote deel (minimaal 80% of zo) geen Taigarietganzen zijn. De enige foto die mij doet denken aan Taigarietganzen is het (familie?)groepje in de Oosthesselerlanden op 5 februari 2010 gefotografeerd door Edwin de Weerd (of Wietze Janse?). Ik weet het niet 100% zeker, de vogels staan zeer waakzaam, dus lange nekken, en wekken daarmee de indruk erg groot te zijn. De snavels zijn niet bij alle vogels lang en ook de onderkant van de snavels lijken niet erg recht. Bij heel veel van de andere vogels zijn de omstandigheden voor een goede beoordeling niet optimaal. De vogel van Dirk Vogt zou een Taigarietgans kunnen zijn, maar de omstandigheden zijn niet erg gunstig. Ik denk dat wat ik eerder heb geschreven nog steeds van toepassing is, namelijk dat we in uitsluitend (99,9%) Toendrarietganzen op zoek zijn naar vogels die nog het meest op Taigarietganzen lijken. Ze worden echter niet meer gevonden omdat ze er niet meer zijn.
 
Een intrigerende vogel vindt ik wel de vogel die op 5 februari 2010 bij Langenboom is gefotografeerd door Justin Jansen.
Titel: Re: rietgans, again...
Bericht door: snwja3 op februari 12, 2010, 22:33:54 pm
Citaat
(of Wietze Janse?)
Foto's zijn  van Edwin, ik heb ze toen alleen ge-upload.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 12, 2010, 22:45:51 pm
(...). Ik weet het niet 100% zeker, de vogels staan zeer waakzaam, dus lange nekken, en wekken daarmee de indruk erg groot te zijn. De snavels zijn niet bij alle vogels lang en ook de onderkant van de snavels lijken niet erg recht. Bij heel veel van de andere vogels zijn de omstandigheden voor een goede beoordeling niet optimaal. (...).
hoi Trinus,
Bedankt voor je vlotte reactie. Je omschrijft hierboven dus een lastig, maar reëel probleem dat je aan de foto's dus -vaak- niet meer goed kunt zien onder wat voor veldomstandigheden ze zijn genomen. Geldt natuurlijk wel voor meer soorten, maar zorgt er dus wel voor dat veel 'potentieel interessante vogels' hierdoor weer afvallen.
 
Dus: gewoon langer het veld in & langdurig kijken čn fotograferen. Tegelijk rijst de vraag: waarom zijn er niet / nauwelijks recente foto's uit Nederland van onomstreden Taigarietganzen die onder (super)optimale veldomstandigheden zijn genomen? Is het echt zo moeilijk? Of, zoals jij stelt, omdat er gewoon geen Taigarietganzen zijn?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op februari 13, 2010, 00:58:58 am
Hallo,
 
Hier nog 2 plaatjes van de taiga`s van Oosterhesselen , vergelijk op het bovenste plaatje de snavels met de klassieke toendra`s die er vlak achter staan (ook alert) ook zie je dat de kin bij de toendra`s een hoek naar beneden maakt, en bij de taiga`s loopt dat gelijk aan de ondersnavel (is ook langer),nagenoeg  recht dus, en in combinatie met de lange zware snavels geeft dat een  topzwaar uiterlijk. In mijn beleving zou een taiga er ongeveer zo uit moeten zien.
 
Het onderste plaatje laat zien dat de vogels toch wel behoorlijk lange nekken hebben.
 
Ik vraag mij nog steeds af waar ik overtuigende foto`s kan vinden van taiga`s  uit de jaren 70/80/90 van de vorige eeuw, die moeten er toch zijn.
 
Groet Edwin.
 
 
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 13, 2010, 10:50:45 am
Ik denk dat wat ik eerder heb geschreven nog steeds van toepassing is, namelijk dat we in uitsluitend (99,9%) Toendrarietganzen op zoek zijn naar vogels die nog het meest op Taigarietganzen lijken. Ze worden echter niet meer gevonden omdat ze er niet meer zijn.

Hoi Trinus,

Met alle respect, maar zolang onduidelijk is of de kenmerken die jij gebruikt echt hout snijden kan ik persoonlijk niet zoveel met dit soort stellige uitspraken. Waar baseer je bijv. op dat de snavels van die vogels van Edwin te kort zouden zijn? Eerder heb je aangegeven dat onderstaande vogels, en dan vooral die in de eerste link, typische fabalissen zouden zijn:

http://www.pbase.com/image/109573294 (http://www.pbase.com/image/109573294)
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31661 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=31661)

Ik kan er eerlijk gezegd niet veel individuen op ontdekken met langere snavels dan de vogels van Edwin. Wat is in jouw ogen trouwens het alternatief? Toendrarietgans? Of denk je dan toch aan een tussen-populatie? In dat laatste geval wordt het allemaal wel heel arbitrair en moet er nog maar een flink robbertje gevochten worden over de precieze definities/grenzen van deze ondersoorten.

Ben nu toch wel benieuwd wat je vind van deze vogels:
http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek)
http://waarnemingen.be/waarneming/view/46222497 (http://waarnemingen.be/waarneming/view/46222497)

Vond het zelf wel bizar om te zien dat er blijkbaar maar 1 fotootje nodig is om allerlei rotsvaste overtuigingen aan het wankelen te brengen.

Lutzen
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 13, 2010, 13:17:18 pm
Hoi Lutzen,
 
Wat je schrijft klopt niet helemaal. Ik heb van de vogels van Edwin geschreven dat die mij doen denken aan Taigarietganzen, maar dat ik niet 100% zeker ben. Ook heb ik geschreven dat de snavels niet bij alle vogels lang zijn, dat is heel wat anders dan dat ik zou hebben beweerd dat ze te kort zijn. Persoonlijk denk ik dat dit wel eens de eerste goed gefotografeerde (familie)groep Taigarietganzen van 2009/2010 in Nederland zou kunnen zijn. Maar voor een definitief oordeel zou ik ze het liefst in het veld willen zien tussen, en ten opzichte van, de andere ganzen. Dan moet het duidelijk te zien zijn. Edwin schreef over deze vogels: "leuke beesten flinke toeters". Dus ik neem aan dat die vogels door hun formaat flink opvielen. Dus hoogstwaarschijnlijk Taigarietganzen.
 
En nee, ik geloof niet in een mengpopulatie.
 
En op die Belgische foto staat op 1 foto 1 vogel die doet denken aan een Taigarietgans. Ik heb het alleen niet zo op losse vogels. Ik ben voor mijzelf pas overtuigd bij het zien van een groep of groepje.
 
In het commentaar op de Dutchbirding-site bij de Zweedse vogels staat dat enkele Zweden beweren dat 20% van de Taigarietganzen zwartsnavels zijn. Dat betekent dus dat 80% geen zwartsnavels zijn en dus vermoedelijk nog steeds voldoen aan het beeld wat iedereen heeft van Taigarietganzen. Het kan toch niet zo zijn dat in Nederland merendeels vogels van dat deel van de populatie wordt gezien wat uit "zwartsnavels" bestaat?
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 14, 2010, 12:21:39 pm
Hallo, Hier nog 2 plaatjes van de taiga`s van Oosterhesselen (....). In mijn beleving zou een taiga er ongeveer zo uit moeten zien. (...) Ik vraag mij nog steeds af waar ik overtuigende foto`s kan vinden van taiga`s  uit de jaren 70/80/90 van de vorige eeuw, die moeten er toch zijn. Groet Edwin.
hoi Edwin,
 
Prachtig dat je weer wat nieuwe foto's hier hebt neergezet. Ik merk dat de discussie nog volop gaande is. Wel tot nu toe geen reactie gehad & gehoord van Sovon c.s. op de (grote?) discrepantie tussen hun wetenschappelijke bevindingen & de discussie die hier, op de website van DB & elders plaatsvindt.
 
Zelf al eens even in wat boeken aan het zoeken geweest naar foto's van Taigarietganzen in Nederland uit de jaren 70/80/90, maar nog niet veel kunnen vinden. Wel was het in die tijd veel minder de gewoonte foto's te plaatsen: er waren toen veel minder vogelfotografen, de apparatuur was heel anders & het afdrukken van (kleuren)foto's had ook nog niet echt een hoge vlucht genomen. Soms was de documentatie van de gepubliceerde foto's ook gebrekkig / afwezig. In het boekje 'Ganzen en zwanen in Nederland' uit 1997 staan wel allerlei zwartwit foto's van ganzen & zwanen, maar alleen met vermelding van de naam van de fotograaf. Plaats, datum en soort worden niet vermeld.
 
In 'het Vogeljaar' (jaargang 51, 2003, pagina 58-64) staat in het artikel 'De West-Siberische Taigagans of Johansens Gans Anser fabalis johanseni' (geschreven door Leo van den Bergh) een hele mooie kleurenfoto met als naam 'Europese Taigagans Anser fabalis fabalis. De foto is in februari 1984 gemaakt op de Kampinasche Heide (fotograaf Leo van den Bergh). Het zou me niets verbazen dat dit een foto is van een zieke en/of aangeschoten gans.
 
Verder staan in dit artikel ook nog twee (of drie?) foto's van een West-Siberische Taigagans (=Johansens Gans) Anser fabalis johanseni. De eerste foto is van maart 2002 uit/bij/van/in Eemdijk (Utrecht); de tweede foto is van oktober 1996 bij Hedikhuizen (Noord-Brabant). Beide foto's zijn gemaakt door Miek Slikkerveer-Bakker. Er staat (op pagina 58) ook nog een foto van een halve gans die door Leo zelf is gemaakt (Druten, maart 1997).
 
Wat bedoel je eigenlijk precies met "in mijn beleving zou een taiga er ongeveer zo uit moeten zien." Welke beleving? Als ik dit vertaal naar een waarneming van een gekleurringde Stormmeeuw, dan wordt dat toch zoiets als 'in mijn beleving zag ik drie drieën en een S op de kleurring staan.' En dat is toch wat anders dan: 'ik heb met 100% zekerheid kunnen vaststellen dat er op de kleurring drie drieën en een S staan.'
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 14, 2010, 17:16:14 pm
(http://waarneming.nl/fotonew/8/1059558.jpg)

Een vogel van een paartje op Texel. Beide vogel tussen de Kol- en Grauwe Ganzen en groot en opvallend.  Verder foto's op http://waarneming.nl/waarneming/view/46380999 (http://waarneming.nl/waarneming/view/46380999)
Op grond van lange snavel, lichaamvorm, lijkt me dit en zijn partner een goede kandidaat fabalis.Maar het wederom niet de toeter waar ik op gehoopt zou hebben.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 14, 2010, 21:49:23 pm
Mooie foto van de Shetland eilanden van vandaag of gisteren; http://www.nature-shetland.co.uk/naturelatest/pics10/3beans.jpg (http://www.nature-shetland.co.uk/naturelatest/pics10/3beans.jpg)

http://www.nature-shetland.co.uk/naturelatest/pics10/fabalis%20beans%20sandwick%2013%20feb%202010%20crop.JPG
http://www.nature-shetland.co.uk/naturelatest/pics10/fabalis%20beans%20sandwick%2013%20feb%202010%20cropii.JPG
http://www.nature-shetland.co.uk/naturelatest/pics10/fabalis%20beans%20sandwick%2013%20feb%202010%20cropiv.JPG
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op februari 14, 2010, 21:49:54 pm
Deze al gezien!?
 
Indrukwekkend.
 
http://waarneming.nl/waarneming/view/46402953 (http://waarneming.nl/waarneming/view/46402953)
http://waarneming.nl/waarneming/view/46398598 (http://waarneming.nl/waarneming/view/46398598)
 
Edwin.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 14, 2010, 23:05:03 pm
Deze al gezien!? Indrukwekkend. http://waarneming.nl/waarneming/view/46402953 (http://waarneming.nl/waarneming/view/46402953) http://waarneming.nl/waarneming/view/46398598 (http://waarneming.nl/waarneming/view/46398598) Edwin
Inderdaad! Zeker de foto's waarbij je één of meer Grauwe Ganzen (en ook Kolgans / Brandgans) door het beeld ziet lopen. Edwin, zeer bedankt voor deze links.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 15, 2010, 10:28:04 am
Ik vraag mij nog steeds af waar ik overtuigende foto's kan vinden van taiga's uit de jaren 70/80/90 van de vorige eeuw, die moeten er toch zijn. Groet Edwin.
hoi Edwin,
 
Bijgaand een kleurenscan van een zeer duidelijke foto van een Taigarietgans in Nederland uit de jaren 80 van de vorige eeuw. Wat vind je van deze vogel?
 
Groetjes, Klaas
 
PS: ondertussen heb ik kleurenscans gemaakt van drie van de artikelen van Leo van den Bergh in 'het Vogeljaar': het artikel over de West-Siberische Taigagans of Johansens Gans (deel 3), het artikel over de Oost-Siberische Taigagans of Middendorff's Gans (deel 4) en het artikel over de Oost-Siberische Toendrarietgans (deel 5). Te dik om hier te plaatsen, maar wie een pdf wil stuurt me maar een bericht / mailtje (klaas.vdijk AT hetnet.nl)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 15, 2010, 17:45:18 pm
In Niedersaksen is nu ook het nodige aan de hand met Taigarietganzen volgens Detlef Gruber zie hiervoor http://aller-voegel.de/AktuelleBeobachtungen.html

In het al eerder aangehaalde artikel van Barthel waar ook een bijlage bij zat (een van de eerste mailtjes, staan ook enkele fotos van Taigarietganzen uit Cuijck van Peter Barthel).
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 16, 2010, 11:01:55 am
In Niedersaksen is nu ook het nodige aan de hand met Taigarietganzen volgens Detlef Gruber zie hiervoor http://aller-voegel.de/AktuelleBeobachtungen.html (http://aller-voegel.de/AktuelleBeobachtungen.html)
hoi Justin,
 
leuk om te lezen dat Taigarietganzen dus ook daar behoorlijk zeldzaam zijn (want rood aangegeven in de lijstjes). Of zou er in deze regio een ander groepje zijn die wel veel Taigarietganzen ziet / telt? Misschien hebben die ook wel een website.
 
Net nog eens even zitten kijken op de site van Sovon. Zie http://www.sovon.nl/soorten.asp?euring=1571&lang=nl (http://www.sovon.nl/soorten.asp?euring=1571&lang=nl) Een mooi stippenkaartje met een gemiddeld soort van verspreiding over alle maanden (?). Maar in ieder geval van na de milleniumwisseling & met volop dikke stippen in Nederland. Ook bij jou in de buurt. M.i. contra de beweringen hierover in de Avifauna van Limburg. Let op: deze stippen (staat in ieder geval in het bijschrift) zijn (bijgeschatte) gemiddelden over het hele jaar (want er staat 'alle maanden'). Dus welke aantallen wel niet in de piekmaanden? Het kan ook zijn dat ik niet goed begrijp wat wordt bedoeld met 'alle maanden.'
 
En nog even, ook op verzoek van Edwin, een andere foto van een Taigarietgans uit de jaren 80. Gefotografeerd op 15 februari 1986 door Arnoud van den Berg bij / in Almere. Gepubliceerd in Dutch Birding (jaargang 1996, aflevering 66) in het artikel over de taxonomie van de Rietgans.
 
Vriendelijke groeten, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 16, 2010, 11:18:31 am
In Niedersaksen is nu ook het nodige aan de hand met Taigarietganzen volgens Detlef Gruber zie hiervoor http://aller-voegel.de/AktuelleBeobachtungen.html (http://aller-voegel.de/AktuelleBeobachtungen.html)

In het al eerder aangehaalde artikel van Barthel waar ook een bijlage bij zat (een van de eerste mailtjes, staan ook enkele fotos van Taigarietganzen uit Cuijck van Peter Barthel).

Er staat ook nog een mooie foto van een groep Taigarietganzen in het artikel van Sangster et al. in de Dutch Birding. In het ID forum van club300 ook enkele topics over de Waldsaatgans, met oa deze foto's uit Mecklenburg-Vorpommern:
 
http://www.club300.de/gallery/idforum_topic.php?id=11939 (http://www.club300.de/gallery/idforum_topic.php?id=11939)
 
Had zelf dit weekend weer veel verwarrende vogels, waaronder een klein groepje niet al te grote Taiga's. Geen goede condities om te fotograferen, dit is het beste wat ik ervan heb weten te maken:
 
(http://waarneming.nl/fotonew/0/1062080.jpg)
 
Heb ook nog wat foto's ingevoerd van een groepje grote rietganzen, met nogal lange nekken en oranje nogal grove  snavels.
 
http://waarneming.nl/waarneming/view/46371173 (http://waarneming.nl/waarneming/view/46371173)
 
Nu maar hopen dat die grote Duitse of Noord-Nederlandse Taigas de komende 2-3 weken nog even naar het zuiden afzakken (of dat die vogels van het Vlijmens Ven weer opduiken).
 
Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 16, 2010, 11:37:00 am
Hoi Lutzen,
 
Wat je schrijft klopt niet helemaal. Ik heb van de vogels van Edwin geschreven dat die mij doen denken aan Taigarietganzen, maar dat ik niet 100% zeker ben. Ook heb ik geschreven dat de snavels niet bij alle vogels lang zijn, dat is heel wat anders dan dat ik zou hebben beweerd dat ze te kort zijn. Persoonlijk denk ik dat dit wel eens de eerste goed gefotografeerde (familie)groep Taigarietganzen van 2009/2010 in Nederland zou kunnen zijn. Maar voor een definitief oordeel zou ik ze het liefst in het veld willen zien tussen, en ten opzichte van, de andere ganzen. Dan moet het duidelijk te zien zijn. Edwin schreef over deze vogels: "leuke beesten flinke toeters". Dus ik neem aan dat die vogels door hun formaat flink opvielen. Dus hoogstwaarschijnlijk Taigarietganzen.
 
En nee, ik geloof niet in een mengpopulatie.
 
En op die Belgische foto staat op 1 foto 1 vogel die doet denken aan een Taigarietgans. Ik heb het alleen niet zo op losse vogels. Ik ben voor mijzelf pas overtuigd bij het zien van een groep of groepje.
 
In het commentaar op de Dutchbirding-site bij de Zweedse vogels staat dat enkele Zweden beweren dat 20% van de Taigarietganzen zwartsnavels zijn. Dat betekent dus dat 80% geen zwartsnavels zijn en dus vermoedelijk nog steeds voldoen aan het beeld wat iedereen heeft van Taigarietganzen. Het kan toch niet zo zijn dat in Nederland merendeels vogels van dat deel van de populatie wordt gezien wat uit "zwartsnavels" bestaat?

Klopt, maar in mijn beleving wekte je met die opmerking wel de suggestie dat de snavels eigenlijk wat aan de korte kant zouden zijn, en dat lijkt me niet juist. Ben wellicht zelf wat bevooroordeeld, maar vind je die vogels uit het Vlijmens Ven nu geen overtuigende Taigarietganzen of niet goed gefotografeerd?
 
http://waarneming.nl/waarneming/view/45927620 (http://waarneming.nl/waarneming/view/45927620)
 
 
Overigens moet je met die maten nogal oppassen, het maakt nogal uit of hoe groot de groep Toendras is waarin je aan het zoeken bent. Heb 3 plaatjes bijgevoegd met kansverdelingen van vleugellengtes (uit BWP) en gewicht (uit Burgers) voor Taigas en Toendras. De rode lijnen zijn de kansverdelingen voor 8 fabalis vogels (2 man, 6 vrouw om rekening te houden met wat kleinere jongen), de blauwe lijnen zijn voor de grootste 8 rossicus vogels in een groep van 8 respectievelijk 60 en 400 vogels (met dezelfde man:vrouw verhouding). Vooral bij de grotere groepen is er dan flink wat overlap in maten. Zo is de zwaarste vogel in een groep van 8 fabalis en 400 rossicus vogels bijna net zo vaak een rossicus als een fabalis. Natuurlijk spelen er meer factoren een rol bij het inschatten van de grootte van vogels, dus ik wil hiermee niet zeggen dat het allemaal onzin is, maar een enkele vogel of klein groepje fabalissen hoeft zeker niet op te vallen in een grote groep rossicus vogels.
 
Lützen
 
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 16, 2010, 12:50:29 pm
Voor de puzzelaars die de beschikking hebben over de data-bijlage van Ruokonen et al.:
 
Ben benieuwd of jullie er achter kunnen komen welke dieren zijn gebruikt om de gemiddelde snavel-lengte van de rossicus ganzen in tabel 4 te berekenen.
 
Lützen
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 17, 2010, 12:38:30 pm
Voor de puzzelaars die de beschikking hebben over de data-bijlage van Ruokonen et al. Ben benieuwd of jullie er achter kunnen komen welke dieren zijn gebruikt om de gemiddelde snavel-lengte van de rossicus ganzen in tabel 4 te berekenen. Lützen
hoi Lützen,
 
Ik zal er eens even beter naar kijken. Kom er nog wel op terug. Gister het artikel van Burgers et al. (1991, Ardea) weer van A-Z doorgelezen. Gedegen, zonder poespas, grote steekproeven, goed onderscheid tussen man / vrouw, jong / adult etc. Gezamelijk geschreven met een statisticus / wiskundige, dus deels met voor mij onbegrijpelijke abacadabra. Maar wel van alle kanten alles bekeken. Staat na 20 jaar nog stevig overeind. Houden nog wel wat slagen om de arm.
 
Hoe zeker is eigenlijk de indeling van hun 7347 adulte Rietganzen in de acht groepen (figuur 2)? En/of, wat gedaan met twijfelgevallen. onduidelijke vogels, intermediairen etc? Zaten die er niet tussen? Of gewoon niet geclassificeerd? Of gewoon maar toegeschreven aan één van de acht groepen?
 
De terugmeldingen kunnen ook opnieuw & beter geanalyseerd worden. Er zijn ondertussen vast meer terugmeldingen (zie ook bv http://www.geese.org/geesedocs/nl/rietgans_info.htm (http://www.geese.org/geesedocs/nl/rietgans_info.htm) ) en het zou helemaal mooi zijn om koppeling op individueel niveau te kunnen maken tussen de terugmeldingen en de biometrie / typenindeling. Geen idee of deze basisinformatie nog beschikbaar is. De terugmeldingen wel, want die staan gewoon in de 'goudmijn' van het VT. Wanneer zijn hun Taigarietganzen gevangen & geringd (alleen in bepaalde winters, of verspreid etc.)?
 
Ik ben er trouwens ook achter gekomen dat Ruokonen et al. wel degelijk wisten dat hun biometrische gegevens misschien niet normaal verdeeld waren. Ze hebben namelijk de Kolmogorov-Smirnov test uitgevoerd en zo'n test moet je uitvoeren als je twijfels hebt of je data wel normaal zijn verdeeld. En op grond daarvan hebben ze de 'kleurhoogte' niet bij de analyse betrokken. De histogrammen (figuur 3) in Burgers et al. illustreren trouwens duidelijk de verschillen tussen man / vrouw.
 
Ik ga binnenkort ook een lijstje maken van 'believers' en 'non-believers'. Bij de Ivoorsnavelspecht had je ook hopen 'believers.'
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 17, 2010, 13:04:28 pm
Gedegen, zonder poespas, grote steekproeven, goed onderscheid tussen man / vrouw, jong / adult etc. Gezamelijk geschreven met een statisticus / wiskundige, dus deels met voor mij onbegrijpelijke abacadabra. Maar wel van alle kanten alles bekeken. Staat na 20 jaar nog stevig overeind. Houden nog wel wat slagen om de arm.

Hoe zeker is eigenlijk de indeling van hun 7347 adulte Rietganzen in de acht groepen (figuur 2)? En/of, wat gedaan met twijfelgevallen. onduidelijke vogels, intermediairen etc? Zaten die er niet tussen? Of gewoon niet geclassificeerd? Of gewoon maar toegeschreven aan één van de acht groepen?

HET probleem met dit artikel is inderdaad dat onduidelijk is hoe goed hun classificatie Taiga vs Toendra is. Snavelvorm is vermoedelijk geen gouden standaard en een onbekend aantal Taiga's en Toendra's is dus in de verkeerde groep terecht gekomen. Misschien zijn alle oranjesnavelige Toendra's wel grof-snavelige Taiga's en alle zwart-snavelige Taiga's dun-snavelige Toendra's?

De statistiek is redelijk standaard, zoals zo vaak zit het probleem vooral in de interpretatie en de conclusies die er worden getrokken (weinig oog voor alternatieve verklaringen).

Lutzen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 17, 2010, 20:32:10 pm
Zit nu in het Britse Museum, maar helaas hier geen Taigarietganzen van Zweden en/of Toendrarietgans van de Tamyr. Wel veel vaag gelabelde beesten uit Nederland en Engeland. Hier kom ik in ieder geval niet veel verder, helaas.....
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 18, 2010, 10:24:46 am
(....). Los daarvan: volgens mij worden Taiga- en Toendrarietgans alleen in Nederland als aparte soorten beschouwd. Afgaande op een persoonlijke mededeling van een van de leden is die beslissing destijds niet eens unaniem door de CSNA genomen.
Beste Ruud,

Ook onze zuiderburen beschouwen Taiga- en Toendrarietgans niet als aparte soorten (hebben ze dat ooit wel eens gedaan?). Via http://www.bahc.be/reports.htm (http://www.bahc.be/reports.htm) is informatie hierover te vinden. Via knip/plak uit de meest recente digitale versie (http://www.bahc.be/Reports/BAHC%20Rapport%2033%202005%20Oriolus%20vol%2073%202007%20p%2052-61.pdf (http://www.bahc.be/Reports/BAHC%20Rapport%2033%202005%20Oriolus%20vol%2073%202007%20p%2052-61.pdf) ):

"Taigarietgans Anser fabilis fabalis. Wat Taigarietgans betreft, is het BAHC voorstander van een heel voorzichtige aanpak. Voorlopig doet het comité liever geen uitspraak over solitaire exemplaren, omdat er nog maar relatief weinig literatuur over de herkenning van deze ondersoort verschenen is en omdat de variatie bij Toendrarietgans toch aanzienlijk blijkt. De determinatie van solitaire exemplaren steunt voornamelijk op structurele kenmerken (snavelvorm, snavellengte, kopvorm, lengte van de hals, …) die lang niet altijd eenvoudig te interpreteren zijn in het veld, laat staan in een beschrijving te vatten. De aanpak is dus wat vergelijkbaar met die voor IJslandse Grutto voor 1999, toen deze ondersoort nog gehomologeerd moest worden: enkel groepjes komen in aanmerking voor aanvaarding. Foto’s en beschrijvingen van solitaire exemplaren worden ondertussen uiteraard zorgvuldig bijgehouden en zullen hopelijk in de toekomst beter beoordeeld kunnen worden."

Vooral de relatie met IJslandse Grutto komt me bekend voor. Zelf hier ook wel eens hoofdpijn gekregen. Het lukte me toen (half / eind maart bij Groningen) niet om in een groep Grutto's alles in te delen in enerzijds limosa en anderzijds islandica. Ook in begin april lukte me dat niet. Maar ik ken andere vogelaars die hier geen enkele moeite mee hebben (dus het met zekerheid  identificeren in binnenlandse gebieden van IJslandse Grutto's in winterkleed, zie bv het artikel van Gerrit Gerritsen & Wim Tijsen in Limosa 2003).
 
 
En in http://www.bahc.be/Reports/BAHC%20Rapport%2030%201998-2003%20Oriolus%20vol%2070%202004%20p101-119.pdf (http://www.bahc.be/Reports/BAHC%20Rapport%2030%201998-2003%20Oriolus%20vol%2070%202004%20p101-119.pdf) staan ook een aantal opmerkelijke uitspraken, rakend aan hetgeen je hierboven stelt.

"Meningen verschillen over wat een soort is. Daarenboven vereist de toepassing van eender welk soortconcept enige subjectiviteit. In grensgevallen hangen taxonomische beslissingen af van het gekozen soortconcept en de interpretatie daarvan. Waar ligt de grens tussen wetenschap en willekeur? Hoe bereiken TC’s beslissingen? Enerzijds is er een soortconcept en zijn er richtlijnen (HELBIG et al. 2002). Anderzijds kan men zich afvragen wat er
gebeurt wanneer TC-leden onderling van interpretatie verschillen. Beslissingen worden wel eens voorgesteld als unaniem maar het tegendeel blijkt al te vaak uit publicaties van individuele taxonomen die TC-leden zijn. Zo blijkt de hoofdauteur van de Guidelines for assigning species rank in de praktijk geen aanhanger van die richtlijnen."

Wat moet ik hier nu weer van denken? Knellende petten of voortschrijdend inzicht? Je weet natuurlijk geen namen meer te noemen?
 
 
En: "Taigarietgans Anser fabalis fabalis is vanaf 2003 aan homologatie onderworpen. Taigarietgans Anser fabalis fabalis (NIEUW BEOORDEELTAXON) 5 en 9 jan 2003, Genk (L), Diepenbeek : 1 ex. (Vanderydt C., Indeherberg M., foto Vanderydt C. arch. BAHC).
Taigarietgans werd in 2003 toegevoegd aan de lijst van de beoordeeltaxa. De motivatie hiervoor is drievoudig:
(1) het aantal waarnemingen van Taigarietgans in Vlaanderen is bijzonder sterk afgenomen. Sommige ganzenkenners, waaronder wijlen Georges Huyskens (1914-2002), vestigden meermaals de aandacht op deze achteruitgang (HUYSKENS 1986; zie MAES 2002 voor een overzicht van de publicaties van deze auteur);
(2) de ware status van Taigarietgans wordt vertekend door verkeerde determinaties van Toendrarietganzen Anser fabalis rossicus;
(3) een reeks controversiële artikelen in Het Vogeljaar (VAN DEN BERGH 2003a en b, 2004) suggereert dat naast fabalis en rossicus ook nog andere Rietgans-taxa in de Lage Landen voorkomen. Aangezien bevestiging hierover ontbreekt is documentatie noodzakelijk. Digitale fotografie kan ongetwijfeld op een constructieve wijze bijdragen tot deze discussie."

Gelukkig staan er nu hier (maar zie ook de website van Dutch Birding) een rij mooie recente foto's van Taigarietganzen. En dat levert in ieder geval een constructieve discussie op.

Vriendelijke groeten,
Klaas
Titel: Re: rietgans, again...
Bericht door: dieterVDH op februari 18, 2010, 20:52:21 pm
als Belgisch vogelkijker heb ik met veel interesse deze discussie gevolgd. Ik heb veel foto's zien passeren en steeds viel er wel ergens iets op te merken dat tegen taiga pleitte. Ik was dus al een klein beetje overtuigd dat taiga's bijna niet te determineren vallen in de lage landen. Tot ik gisteren de foto's van Johan Buckens zag, een collega vogelkijker uit Belgie. Hij had namelijk een hele groep rietganzen gevonden in Cadzand! en foto's zijn te bekijken op deze site (waarnemingen van gisteren) en waarschijnlijk zal hij nog wel meer foto's posten later. Ik ben vandaag dze groep gaan bekijken, waarin zich in totaal 24 vogels bevonden. Er zit 1 kleine rietgans tussen en misschien 4-5 toendra's, maar al de andere vogels zijn volgens mij zonder enige twijfel taiga's (wat dus ook al een pluspunt is, want taigarietganzen zouden steeds in families fourageren). Vogels zijn duidelijk groter dan toendras in groep, lange hals, lange snavel die in 1 lijn doorloopt naar voorhoofd, bijna geen zwart in snavel en witte kolletje bij meeste ook aanwezig. Ik had daarom meer interesse verwacht van Nederlandse vogelkijkers (en trouwens ook Belgische vogelkijkers), maar vandaag waren Johan en ik (en mijn broer) blijkbaar de enige geinteresseerden. Ik zou zeggen zeker een aanrader en heel leerrijke vogels. Bovendien weet ik nu zeker dat ze toch bestaan ;-)

Dieter Van den Heuvel
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 18, 2010, 21:13:15 pm
Via internet heb ik een gedrukte uitgave van het artikel over Sushkins rietganzen in Limosa (1973) opgesnord. Zo handig als Klaas met scannen is, ben ik niet. Maar hier de bladzijden...
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 18, 2010, 21:26:23 pm
Beste Dieter,

Ben het volledig met je eens dat er veel vogels zijn langsgekomen die tegen fabalis pleiten, maar is de range van variatie van rossicus dan wel zo groot, en de marge bij fabalis heel klein? Ik ben het met je eens dat het Belgische groepje fantastisch is, maar zijn dit geen extreme vogels in de fabalis wereld?
Groet, Justin
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 18, 2010, 23:35:11 pm
als Belgisch vogelkijker heb ik met veel interesse deze discussie gevolgd. Ik heb veel foto's zien passeren en steeds viel er wel ergens iets op te merken dat tegen taiga pleitte. Ik was dus al een klein beetje overtuigd dat taiga's bijna niet te determineren vallen in de lage landen. Tot ik gisteren de foto's van Johan Buckens zag, een collega vogelkijker uit Belgie. Hij had namelijk een hele groep rietganzen gevonden in Cadzand! en foto's zijn te bekijken op deze site (waarnemingen van gisteren) en waarschijnlijk zal hij nog wel meer foto's posten later. Ik ben vandaag dze groep gaan bekijken, waarin zich in totaal 24 vogels bevonden. Er zit 1 kleine rietgans tussen en misschien 4-5 toendra's, maar al de andere vogels zijn volgens mij zonder enige twijfel taiga's (wat dus ook al een pluspunt is, want taigarietganzen zouden steeds in families fourageren). Vogels zijn duidelijk groter dan toendras in groep, lange hals, lange snavel die in 1 lijn doorloopt naar voorhoofd, bijna geen zwart in snavel en witte kolletje bij meeste ook aanwezig. Ik had daarom meer interesse verwacht van Nederlandse vogelkijkers (en trouwens ook Belgische vogelkijkers), maar vandaag waren Johan en ik (en mijn broer) blijkbaar de enige geinteresseerden. Ik zou zeggen zeker een aanrader en heel leerrijke vogels. Bovendien weet ik nu zeker dat ze toch bestaan ;-)

Dieter Van den Heuvel
Hallo Dieter,
Die vogels zien er inderdaad heel goed uit. Maar hoe zeker is het dat het om wilde vogels gaat? De waarnemingsplekken liggen vrijwel direct naast Natuurreservaat het Zwin, een gebied waar voorheen meende ik ook wel veel watervogels vrijvliegend werden gehouden. Ik ben niet op de hoogte van de recente situatie, misschien dat een lokaal bekende daar iets over kan zeggen?
Titel: Re: rietgans, again...
Bericht door: Johan Buckens op februari 18, 2010, 23:38:51 pm
Dag Justin,

Cadzand ligt in Nederland, het groepje Taiga's zit net over de grens (helaas voor ons).
Ik was blij eens echte Taiga's te zien , net als Dieter heb ik ook hier het Taigaverhaal zitten volgen.
Moesten ze nu nog één keertje één kilometer willen opschuiven richting België is het helemaal goed.

En Cygnus, zo erg is het niet gesteld met het rondvliegen van parkvogels in het Zwin. Taigarietganzen hebben ze niet, laat staan een groep van 20 vogels!

groet,
Johan
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 19, 2010, 00:01:56 am
En Cygnus, zo erg is het niet gesteld met het rondvliegen van parkvogels in het Zwin. Taigarietganzen hebben ze niet, laat staan een groep van 20 vogels!
Johan, bedankt voor deze informatie. Belangrijk dat het bevestigd is dat daar geen Taigarietganzen worden gehouden. Mogelijk betreft dit een groepje vogels die zich normaliter in de Yare valley in Norfolk ophouden en iets zijn afgezakt naar het zuiden. Als dat zo is dan zouden dit Zweedse (broed)vogels moeten zijn. 
Titel: Re: rietgans, again...
Bericht door: wjfontijn op februari 19, 2010, 00:27:13 am
Via internet heb ik een gedrukte uitgave van het artikel over Sushkins rietganzen in Limosa (1973) opgesnord. Zo handig als Klaas met scannen is, ben ik niet. Maar hier de bladzijden...

Bedankt Albert. Herinner me hierdoor ineens een interessante vogel uit de groep bij Woldendorp. Deze vogel liep in een van de familiegroepjes Taiga's en viel naast de grootte en bouw (die op de foto's wat wegvalt trouwens) meteen op door de fletsrozige snavel. Gedurende de korte tijd dat de vogels redelijk dichtbij de weg liepen, kwam ik de vogel nog een paar keer tegen maar verder niet veel aandacht meer aan besteed. Zojuist de foto's doorgespit en gelukkig stond ie er een paar keer op (zie bijlagen, betreft de vogel helemaal links). Niet elke foto is even scherp, maar misschien is het voor de verdere discussie wel een interessant beest om even te melden.   
 
Leo van den Bergh beschrijft in een van zijn artikelen in Limosa de Sushkins Gans en Buturlingans (Limosa 52 (5): 200-209). Suskhins Gans Anser fabalis neglectus heeft een roze snavel en roze poten. Van deze vorm worden de nodige waarnemingen genoemd waaronder enkele groepen van redelijk recente datum: 3 januari 2004 bij Zevenhuizen in Groningen (15 ex., pers. obs. LvdB) en eind dec 2003-begin feb 2004 maximaal 38 ex. in de Wieringermeer (meerdere waarnemers, iemand?, foto's?). De Buturlingans wordt door Leo beschouwd als een kleurafwijking (de carneirostris-afwijking) en komt zowel voor bij Taiga's als Toendra's. Deze vogels hebben wel een roze snavel maar wijken verder niet af van normale vogels. De vogel van Woldendorp heeft oranje poten en betreft dus mogelijk zo'n kleurafwijking.
 
Groeten,
 
Willem-Jan
 
 
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 19, 2010, 11:06:54 am
Beste Dieter,

Ben het volledig met je eens dat er veel vogels zijn langsgekomen die tegen fabalis pleiten, maar is de range van variatie van rossicus dan wel zo groot, en de marge bij fabalis heel klein? Ik ben het met je eens dat het Belgische groepje fantastisch is, maar zijn dit geen extreme vogels in de fabalis wereld?
Groet, Justin
Alle zekere (maar geef gelijk toe dat mijn definitie daarvan nogal eens wisselt) Taigas die ik tot nu toe heb gezien waren in mijn ogen behoorlijk verschillend van elkaar:

http://waarneming.nl/waarneming/view/45927620
http://waarneming.nl/waarneming/view/907222
http://waarneming.nl/waarneming/view/708291
http://waarneming.nl/waarneming/view/646678
http://waarneming.nl/waarneming/view/3498334

Dat ook fabalis nogal variabel is blijkt m.i. ook uit foto’s op Finse en Zweedse sites. Die inschatting is op zich niet anders geworden nu er ook in NL heel opvallende fabalis vogels worden gezien (want dat die vogels bestonden wist ik al, ook daarvan nl. veel voorbeelden op die sites). Wel moet ik toegeven dat ik niet uit kan sluiten dat een deel van de minder karakteristieke vogels toch rossicus zijn (zie discussie op DB-site en eerder gelinkt pdf-je uit Noorwegen), dus als uiteindelijk mocht blijken dat alleen dit soort extreme vogels echte fabalis zijn dan heb ik al die tijd gewoon mis gezeten en me toch blind gestaard op de (blijkbaar enorme) variatie binnen rossicus. Dat is een reële mogelijkheid, want hoewel je bijv. binnen de Schotse winter-populatie wel veel variatie ziet, liggen alle kenmerken (en dan bedoel ik vooral proporties) daar gemiddeld genomen toch wel veel duidelijker richting fabalis dan bij veel vogels die ik in het verleden als zekere Taiga heb ingevoerd:

http://waarneming.nl/waarneming/view/704447
http://waarneming.nl/waarneming/view/724030
http://waarneming.nl/waarneming/view/1867641
http://waarneming.nl/waarneming/view/3528000

Ook het feit dat er nu wel een influx is van dit soort extreme vogels, terwijl er geen duidelijke toename is van het aantal semi-Taigas (mijn inschatting) wijst er op dat er wellicht toch een verschil is in geografische herkomst (wat dat dan ook betekent). Zoals ik eerder heb aangegeven zal ik dit soort vogels de komende tijd daarom als rietgans spec. invoeren. Het lijkt me trouwens duidelijk dat vogels in deze laatste categorie verantwoordelijk zijn voor de enorme discrepantie tussen in NL gemelde aantallen fabalis (kan me niet voorstellen dat Leo wel van die extreme vogels ziet). Zolang er geen betere beschrijving komt van de relevante kenmerken voor zowel Taiga als Toendra (de laatste is in mijn ogen voor veel mensen nu vooral een soort niet-Taiga) blijft de vraag wie er nu gelijk heeft (Leo vd Bergh vs. Thomas Heinicke) wat mij betreft tenminste nog even open (al staan de Duitsers wel voor).

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 19, 2010, 11:35:12 am
Ik zal er eens even beter naar kijken. Kom er nog wel op terug.

Verwacht eerlijk gezegd niet dat je er zelf achter gaat komen, dus hierbij het juiste antwoord:

ROSSICUS
mtdna  number museum             locality      date bill.length
 SER1  60.858   ZMUC        Novaja Semlja 24.5.1903        58.0
 SER1  R24954   ZMMU       Kola peninsula 19.7.1876        61.0
 SER1  R87957   ZMMU       Kola Peninsula  8.8.1955        55.1
 ROS2 R105320   ZMMU       Kola Peninsula      1977        61.9
 ROS2 R114975   ZMMU Novaja Zemlja Island  4.8.1997        54.0
 ROS2  NMR 15    NMR       Kola peninsula 19.7.1876        58.1
 ROS2   23546   ZMUO        Novaja Zemlja 18.8.1903        59.2
 ROS3   NMR 1    NMR       Kola peninsula 19.7.1876        57.0
 SER1  R24980   ZMMU            Ust' Port  2.5.1908        56.8
 SER1  R85706   ZMMU               Anabar 15.6.1959        57.3

SERRIROSTRIS
mtdna         number museum          locality      date bill.length
 ROS4         R85465   ZMMU       Krasnojarsk 12.5.1959        62.4
 SER1 1938.12.14.277   BMNH           Jenisei  3.7.1895        61.2
 SER1          16227   ZMUO      Kolyma Delta 14.7.1916        68.9
 SER1         R79404   ZMMU Novosibirskie Ova 20.8.1954        59.7
 SER1         R25013   ZMMU           Pohodsk 10.9.1905        64.0
 SER1         R25000   ZMMU           Pohodsk 21.5.1905        62.3
 SER1         R25010   ZMMU           Pohodsk 10.7.1905        66.1
 SER1         R25004   ZMMU           Pohodsk  7.7.1905        59.9
 SER1         R25016   ZMMU           Pohodsk 21.8.1905        58.8
 SER1         R25011   ZMMU           Pohodsk 23.5.1905        59.2
 SER1         R25003   ZMMU           Pohodsk  7.6.1905        65.0
 SER4          16226   ZMUO      Kolyma Delta  8.7.1916        66.1
 SER3         R25005   ZMMU           Pohodsk 16.5.1905        64.0
 SER3         R25001   ZMMU           Pohodsk 16.5.1905        62.9


Opvallend genoeg zit die ROS4 dus in de serrirostris groep. Ruokonen et al. schrijven daarover: “Additionally, one individual, to which no subspecies was originally assigned, remained unclear. Independent re-identification and discriminant function analysis supported either taiga subspecies (fabalis or middendorffii) or serrirostris, but based on mtDNA this bird was placed into the rossicus group (the sole carrier of ROS4 haplotype in Fig. 3).” Wie het nog snapt mag het zeggen.

Ook in de rossicus groep is iets opvallends aan de hand. Van de eerste 3-4 SER1 vogels kan ik me gezien de lokatie voorstellen dat dat ook de primaire identificatie was. De laatste vogel komt echter uit het behoorlijk verre oosten, dus daar ligt dat niet direct voor de hand (lokatie valt volgens hun eigen kaartje binnen het serrirostris gebied). Deze vogel heeft een nogal korte snavel (zou de kortste snavel zijn geweest binnen de serrirostris groep). Een conflicterend genotype kan hier toch nauwelijks de reden zijn geweest om nog eens naar deze vogel te kijken (in het oosten gevangen en SER1 genotype) en wordt ook niet beschreven in paragraaf 3.6 (Disagreements between morphological identification and genetical results).

Tikje vaag allemaal.

Lützen

Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 19, 2010, 11:56:37 am
Verwacht eerlijk gezegd niet dat je er zelf achter gaat komen, dus hierbij het juiste antwoord:
Hoi Lützen,
Hoe ben jij er achtergekomen welke vogels het betreft? Zelf uitgerekend of bij 1 van de auteurs nagevraagd?
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 19, 2010, 12:12:05 pm
Mogelijk betreft dit een groepje vogels die zich normaliter in de Yare valley in Norfolk ophouden en iets zijn afgezakt naar het zuiden. Als dat zo is dan zouden dit Zweedse (broed)vogels moeten zijn.
Ik heb nog even gekeken naar de situatie m.b.t. de in Norfolk overwinterende Taigarietganzen. Op de website van Birding East Anglia staat: "The maximum count of Taiga Bean Geese in the Yare Valley was around eighty-four. The cold weather may have encouraged them to wander as three were found in Bedfordshire and another three in Cambridgeshire. Another was with the Pink-feet near Docking 13th".
In de winter 2008/2009 werden in Norfolk (Yare Valley) maximaal nog 206 Taigarietganzen geteld. Dit jaar dus fors minder, blijkbaar vanwege het weer. Het voorkomen van een groepje aan de kust bij Cadzand zou een aanwijzing kunnen zijn dat het daar om Norfolk-vogels gaat.
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 19, 2010, 12:58:05 pm
Verwacht eerlijk gezegd niet dat je er zelf achter gaat komen, dus hierbij het juiste antwoord:
Hoi Lützen,
Hoe ben jij er achtergekomen welke vogels het betreft? Zelf uitgerekend of bij 1 van de auteurs nagevraagd?

Toen ik er in eerste instantie zelf niet 123 uitkwam, heb ik er wat brute rekenkracht tegen aangegooid. Dit is de enige combinatie waarmee je (exact) uitkomt op de getallen in tabel 4. Het zou natuurlijk nog wel zo kunnen zijn dat er iets mis is gegaan bij hun data-analyse of bij het samenstellen van de gegevens-bijlage, maar de kans lijkt me eerlijk gezegd groter dat ze het niet belangrijk genoeg vonden om gedetailleerd te beschrijven. De weg naar de hel is nu eenmaal geplaveid met goede bedoelingen.

Heb er nav deze resultaten wel over gedacht contact op te nemen met Minna Ruokonen, en dan vooral om te vragen wat nu de oorspronkelijke studie-opzet was, maar veel verder dan een gedachte is het nog niet gekomen. Uiteindelijk maakt het ook voor het mtDNA boompje en de positie van Middendorffi allemaal niet zoveel uit, en dat is m.i. toch waar het in dit artikel om draait. Die fenotypes moet je zo snel mogelijk vergeten, want die zijn door die her-determinaties nauwelijks meer te interpreteren.

Gezien de huidige discussie over de Zweedse en Noorse vogels is het overigens wel jammer dat er niet wat meer vogels uit deze landen (Zweden n=3; Noorwegen n=2) in het onderzoek zijn betrokken.

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 19, 2010, 13:14:54 pm
Mogelijk betreft dit een groepje vogels die zich normaliter in de Yare valley in Norfolk ophouden en iets zijn afgezakt naar het zuiden. Als dat zo is dan zouden dit Zweedse (broed)vogels moeten zijn.
Ik heb nog even gekeken naar de situatie m.b.t. de in Norfolk overwinterende Taigarietganzen. Op de website van Birding East Anglia staat: "The maximum count of Taiga Bean Geese in the Yare Valley was around eighty-four. The cold weather may have encouraged them to wander as three were found in Bedfordshire and another three in Cambridgeshire. Another was with the Pink-feet near Docking 13th".
In de winter 2008/2009 werden in Norfolk (Yare Valley) maximaal nog 206 Taigarietganzen geteld. Dit jaar dus fors minder, blijkbaar vanwege het weer. Het voorkomen van een groepje aan de kust bij Cadzand zou een aanwijzing kunnen zijn dat het daar om Norfolk-vogels gaat.

Zouden natuurlijk ook de vogels van het Slammanan plateau kunnen zijn, al begrijp ik van de website dat iig een deel ervan inmiddels weer terug is:

http://www.bean-geese.pwp.blueyonder.co.uk/recent_news%20current.htm

Opmerking over de departure time is ook voor de Nederlandse situatie relevant. In mijn ervaring kunnen ze eind februari plotseling verdwenen zijn. Niet uitstellen dus dat bezoekje aan Zeeland/Groningen.

Kijk ook even naar het blog van Lee Evans (19-feb-2010):

http://uk400clubrarebirdalert.blogspot.com/

Isotopen?  ;D

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 19, 2010, 13:22:35 pm
Beste Dieter,

Ben het volledig met je eens dat er veel vogels zijn langsgekomen die tegen fabalis pleiten, maar is de range van variatie van rossicus dan wel zo groot, en de marge bij fabalis heel klein? Ik ben het met je eens dat het Belgische groepje fantastisch is, maar zijn dit geen extreme vogels in de fabalis wereld?
Groet, Justin

Kwam bij het zoeken naar de Slammanan website nog deze foto's tegen:

http://searchphotoscot.co.uk/Gallery/Search.aspx?storyId=15

Kijk bijv. eens naar deze:
http://searchphotoscot.co.uk/ImageServer.ashx?id=210&size=786

Zien er zo al weer een stuk minder klassiek uit, toch?

Lützen
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 19, 2010, 13:40:32 pm
Ik zal er eens even beter naar kijken. Kom er nog wel op terug.
Verwacht eerlijk gezegd niet dat je er zelf achter gaat komen, dus hierbij het juiste antwoord:

mtdna         number museum          locality      date bill.length
 ROS4         R85465   ZMMU       Krasnojarsk 12.5.1959        62.4
Opvallend genoeg zit die ROS4 dus in de serrirostris groep. Ruokonen et al. schrijven daarover: “Additionally, one individual, to which no subspecies was originally assigned, remained unclear. Independent re-identification and discriminant function analysis supported either taiga subspecies (fabalis or middendorffii) or serrirostris, but based on mtDNA this bird was placed into the rossicus group (the sole carrier of ROS4 haplotype in Fig. 3).” Wie het nog snapt mag het zeggen. (....). Tikje vaag allemaal. Lützen
hoi Lützen, ik was er al eens naar aan het kijken geweest, maar was wat vastgelopen op de zinsnede dat één van de mysterieuze ganzen een 'subadult' was. En subadulte Rietganzen broeden nu éénmaal niet & zijn dus ook geen broedvogels. En zegt de verspreiding van subadulte Rietganzen tijdens de zomer iets over het broedareaal? Bij Kokmeeuwen is dit in ieder geval niet zo. Subadulte Scholeksters uit Noord-Rusland overzomeren ook wel op Schiermonnikoog. En ze beschrijven ook nog een een 'nesting female' (dus een echte broedvogel!) van Nova Zembla die was gedetermineerd als Kleine Rietgans (maar in werkelijkheid wellicht een Suskins Gans?), maar die op grond van de mtDNA een rossicus moest zijn.
 
En ik zat nog steeds aan te hikken dat men in dit artikel -kennelijk- vogels met een SER haplotype ook als rossicus kan benoemen (en omgekeerd etc). Ik begreep het dus ook niet allemaal zo goed & zat hier dus nog wat op te broeden. En bedenk dat bij 15 van de 146 Rietganzen (10.3%, en niet 7.5%, want Kleine Rietgans doet niet mee, want daar zijn geen twijfels over) geen overeenstemming was tussen het mtDNA haplotype (maar nog steeds is me niet duidelijk hoe je dat indeelt) en de maten.
 
Echter, mits ik het goed begrijp, komen Burgers et al via hun discriminantanalyse uit op ongeveer eenzelfde foutenpercentage (tabel 2). Bij mannetjes 15-16% fout op grond van een discriminantfunctie met drie maten (gewicht, vleugel, snavel) en bij vrouwtjes 11-13%. En Burgers et al stellen dan ook: the error rates indicate that we cannot trust on the three reported measurements made on a bird in order to predict with certainty its 'visual type.'
 
Toeval of niet?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 19, 2010, 13:55:00 pm
Via internet heb ik een gedrukte uitgave van het artikel over Sushkins rietganzen in Limosa (1973) opgesnord. Zo handig als Klaas met scannen is, ben ik niet. Maar hier de bladzijden.
hoi Albert,
 
Zeer bedankt voor het inscannen van dit artikel over de Suskins Gans. Ik zit al tijden met smart te wachten op het afronden van de digitalisering van alle afleveringen van Limosa. Dit schijnt bijna af te zijn en dan staat alles gewoon op de site van de NOU.
 
Mij viel meteen op dat er sprake was van 'intermediairen.' (bij #2): 'Geringd en losgelaten met 9 andere Rietganzen waarvan 7 de snavelkenmerken van fabalis vertoonden en 2 intermediar waren tussen fabalis en rossicus.'
 
Sangster & Oreel (DB 1996) noemen het ontbreken van intermediairen etc. juist als belangrijk criterium om Taigarietgans / Toendrarietgans te splitten (zie ook mijn opmerkingen over overlap in maten etc).
 
Gisteravond ook het (stok)oude artikel uit 1956 in Ardea van Kist gedownload en doorgelezen. Helaas ontbreekt pagina 1-2, maar er blijft voldoende over om te lezen. Duidelijk is ook dat Kist & Voous het bepaald niet met elkaar eens waren. Maar: Kist is ook een echte alfa (jurist / advocaat) en bekijkt alles vanuit de bril van een veldman. Tuurlijk, men wist toen nog niet zoveel & moest ook roeien met de riemen die men had. En wel of niet twijfelganzen / intermediairen?
 
Vriendelijke groeten,
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 20, 2010, 13:44:49 pm
Verwacht eerlijk gezegd niet dat je er zelf achter gaat komen, dus hierbij het juiste antwoord:
ROSSICUS
mtdna  number museum             locality      date bill.length
 SER1  R24980   ZMMU            Ust' Port  2.5.1908        56.8
 SER1  R85706   ZMMU               Anabar 15.6.1959        57.3

SERRIROSTRIS
mtdna         number museum          locality      date bill.length
 SER1         R79404   ZMMU Novosibirskie Ova 20.8.1954        59.7

(...). Tikje vaag allemaal. Lützen
Het is erg vaag.

Ust Port ligt aan de oostelijke oever van de Jenisei, in de zuidwesthoek van Taimyr. Maar 2 mei is volgens mij voor die regionen nog veel & veel te vroeg voor broeden (ook al in 1908). Dus m.i. plm. onmogelijk om hier -met terugwerkende kracht?- een broedstatus aan vast te plakken.

Anabar is een rivier die ten oosten van Taimyr ligt (ongeveer 115 graden OL) en west van de Lenadelta. Stip staat correct op het kaartje. Vraag is alleen hoe zeker het is of daar ergens de grens ligt tussen rossicus en serrirostris. Hangt er maar net vanaf welke bron je raadpleegt.

Novosibirskie Ova zijn de Nieuwsiberische eilanden, maar daar broeden volgens het kaartje helemaal geen Rietganzen! Er staat wel een stip op hun kaartje op de Nieuwsiberische eilanden. Is natuurlijk toendra, maar is 20 augustus 1954 niet wat te laat voor een zekere broedvogel? Of was 1954 een zeer laat seizoen? Vaag hoor. De hele tekst door voortdurend brabbelen over broedvogels / zekere broedvogels en dan vogels verzamelen van een locatie waar helemaal niet gebroed wordt. Hoef je geen betastudie voor gevolgd te hebben om dit vaag / merkwaardig te vinden.

----------------------------

Nog eens even nagedacht over hun determinatieproblemen en hun geworstel om de juiste mtDNA typen bij de juiste (onder)soort onder te brengen. Volgens mij is hun foutenpercentage nog veel hoger dan de 7,5% (15 van de 199) die ze ons proberen voor te spiegelen. En ook nog hoger dan de 10,3% die ik in een eerdere bijdrage opvoerde. Want ze konden volgens mij alleen maar problemen hebben met die monsters / gevallen waarvan er maten / foto's waren. Dan vallen dus een heleboel af & blijven er bij de Rietganzen (dus fabalis, middendorffii, rossicus & serrirostris tezamen) 58 monsters met maten etc. over. En die 58 staan ook allemaal netjes in de bijlage tabel (tabel S1). Hiervan waren er dus 15 (=26%) fout gedetermineerd. Dus meer dan een kwart van de goed bekeken gevallen van Rietgans waren eerst fout gedetermineerd etc. Dat is niet mis. De vraag is dan natuurlijk ook hoe het ging met de overige 88 monsters (146 - 58) van Rietganzen waar dus helemaal niet bekend was over maten etc. (was er wel iets bekend over de leeftijd?). Zitten / zaten hier ook zoveel fouten tussen? Of begrijp ik het niet goed en zit ik hier maar wartaal uit te slaan?

---------------------------
Ongeveer een jaar geleden heeft de CDNA besloten Anser middendorffii als aparte soort te erkennen. De soort is volgens http://www.dutchbirding.nl/content/page/files/WPnamenlijstDBArnoudBvdBfeb2010.pdf (http://www.dutchbirding.nl/content/page/files/WPnamenlijstDBArnoudBvdBfeb2010.pdf) nog nooit in de WP gezien. Wel is momenteel een (oud) geval in roulatie bij de CDNA, zie http://www.dutchbirding.nl/cdna.php?gevallen=1 (http://www.dutchbirding.nl/cdna.php?gevallen=1) Vreemd genoeg wordt middendorffii hier als ondersoort van Toendrarietgans opgevoerd. Daarentegen zijn er meer dan een voetbalelftal aan 'believers' (Jan Beekman, Leo van den Bergh, Cor Berrevoets, Fred Cottaar, Bart Ebbinge, Romke Kleefstra, Kees Koffijberg, Gert Ottens, Jules Phillipona, Jouke Prop, Marc van Roomen, Bernard Spaans, Berend Voslamber, Erik van Winden en Menno Zijlstra) die in een gezamenlijke publicatie stellen dat 'mag worden aangenomen dat er in de winter van 2001/02 meerdere tientallen Middendorff's Ganzen in Nederland zaten' (Sovon wavo-rapport 2001/02).

Goed, wat hebben Ruokonen et al eigenlijk te melden over Middendorff's Gans? Volgens tabel 1 (pagina 556) komen er 19 monsters van Kamchatka. Volgens hun eigen kaartje allemaal uit het zuidpuntje van Kamchatka, ten zuiden van het bekende broedgebied van Rietganzen. Alle 19 monsters staan ook netjes vermeld in de bijlage. Allemaal zonder maten, zonder informatie over leeftijd en allemaal verzameld in 2000. Dag en maand worden niet vermeld en zijn dus - kennelijk- onbekend. Welk criterium legt de CDNA ook alweer aan om gevallen van zeldzame soorten te aanvaarden?

--haplotype MID1: monsters MK 1, 2, 3, 4, 6, 7, 8, 9 ('MK' = code voor middendorffii kamchatka?) en monsters SK 1, 2 ('SK' = code voor serrirostris kamchatka?)
--haplotype MID3: monster MK 10.
--haplotype SER1: monsters SK 5, 7, 10, 11.
--haplotype SER2: monsters SK 3, 4, 6, 8.

Hoe is eigenlijk de (onder)soort van deze monsters bepaald? Was er iets bekend over de broedstatus, leeftijd etc van deze monsters? Waar zijn monsters MK5 en SK2 gebleven (ontbreken in de reeks)?

Dan is er ook nog de locatie Khabarovsk. Staat goed op de kaart vermeld, maar wederom aan de zuidrand van het broedareaal van middendorffii. Er staan 12 monsters uit Khabarovsk in tabel 2 (hier aangegeven als 'Russia Amur') en ze zijn alle 12 in de bijlage terug te vinden. Allemaal verzameld in april 2000. De vraag is natuurlijk wat hier in april aan (onder)soort(en) Rietganzen voorkomen. Alleen maar middendorffii, of ook serrirostris? Iemand die daar wat zinnigs over weet te zeggen? April is (veel) te vroeg voor broeden in deze regio? [weet ik niet zeker, maar m.i. is het daar een flink koude wereld].

--haplotype MID1: monsters KH1, 2, 4, 7, 8, 9, 13, 14.
--haplotype MID4: monster KH6. [de enige].
--haplotype MID5: monster KH3. 5, 12.

Monsters KH10 en KH11 ontbreken.

------------------------------------
Tot slot. Ik begrijp nog steeds niet waarom er geen haplotypes FAB2, FAB 4 en FAB5 zijn vermeld (wel haplotypes FAB1, FAB3 en FAB6). Hapotype ROS1 ontbreekt ook (ROS 2, ROS3 en ROS4 staan weer wel vermeld). Waarom niet gewoon doornummeren? Of heeft dit iets te maken met die duizendmaal uitgevoerde ingewikkelde berekeningen? Vaagjes is het inderdaad allemaal wel!

Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: andre op februari 20, 2010, 15:29:13 pm
De Woldendorp vogels zijn nog steeds ter plaatse en laten zich erg leuk bekijken .
 
Andre
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 21, 2010, 11:20:50 am
Nog wat Shetland vogels van de afgelopen dagen;

http://www.nature-shetland.co.uk/naturelatest/pics10/Bean%20Geese%20(Burravoe)%203-1.JPG
http://www.nature-shetland.co.uk/naturelatest/pics10/Taiga13RR.jpg
Titel: Re: rietgans, again...
Bericht door: Martijn Bot op februari 21, 2010, 21:28:30 pm
Gisteren plofte er ook kortstondig een groepje neer naast de vuilstort in de stad Groningen (zij het wat ver weg):
http://martijnbot.fotopic.net/p63396083.html (http://martijnbot.fotopic.net/p63396083.html)
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 22, 2010, 09:18:38 am
Weer een interessant (online)-artikel gevonden met hypotheses over trekroutes e.d. van Taigarietganzen:
SKYLLBERG, U., HANSSON, P., ANDERSSON, Ö., BERNHARDTSON, P., GUSTAFSSON, R., LAISFELDT, M., NAUDOT, E., & NORDLUND, M., 2008. Spring staging, flyways and population estimate of the northern Scandinavian Taiga Bean Goose Anser f. fabalis in 2002–2006. VOGELWELT 129: 253–262.
Link: http://www.sofnet.org/file/22-Skyllberg_et_al.pdf?Path=2&ID=2201&File=22-Skyllberg_et_al.pdf (http://www.sofnet.org/file/22-Skyllberg_et_al.pdf?Path=2&ID=2201&File=22-Skyllberg_et_al.pdf)
 
en nog een sfeerimpressie:
SKYLLBERG, U., HANSSON, P & BERNHARDTSON, P. 2009. Pĺ besök i den skandinaviska taigasädgĺsens vinterkvarter. VĹR FĹGELVÄRLD nr 2 / 2009.  (vrij vertaald: Op bezoek in de winterkwartieren van de Scandinavische Taigarietganzen).
Link: http://www.sofnet.org/file/VF2-200924-27.pdf?Path=2&ID=2201&File=VF2-200924-27.pdf (http://www.sofnet.org/file/VF2-200924-27.pdf?Path=2&ID=2201&File=VF2-200924-27.pdf)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 22, 2010, 09:42:06 am
Zie voor de Zweedse situatie een reactie van Heinicke; http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek)
Titel: Re: rietgans, again...
Bericht door: Maarten W. Kaales op februari 22, 2010, 10:15:50 am
Deze vogel zag ik afgelopen zaterdag in een groep van ca 1000 Tundra's (laat ik zeggen dat ik er een Tundra's van heb gemaakt). Van onderstaande vogel heb ik dan ook een Taigarietgans gemaakt.
 
(http://farm5.static.flickr.com/4039/4376868434_76f40302ba_o.jpg)
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op februari 22, 2010, 10:24:52 am
Citaat van: lupokatja

Kijk ook even naar het blog van Lee Evans (19-feb-2010):

http://uk400clubrarebirdalert.blogspot.com/ (http://uk400clubrarebirdalert.blogspot.com/)

Isotopen?  ;D

Lützen

Volgens mij gaat Lee Evans hier een beetje de mist in met 'deeper-based bill'.

De duidelijkste foto van middendorf 's die ik in mijn lijstje URL's heb staan, is deze: http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg (http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg)

Ook de foto's (met name de onderste) van Peter de Haas op Birdpix laten opvallend dikke, gebogen ondersnavels zien. De groep op één van zijn foto's is aardig homogeen qua kleurverdeling op de snavels. > http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=taigarietgans&personal_album=0 (http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=taigarietgans&personal_album=0)

De Shetlandvogels zouden natuurlijk 'gewoon' een groepje Europese vogels uit Norfolk kunnen zijn. Maar dat zal jij ook gedacht hebben...

@ Justin, thanks! Die laatste link van je had ik nog niet...


Nog wat anders. Ik las gisteren nog even in het stuk van Rogacheva (1992). Zij heeft het wel over een zone waar hybridisatie van drie ondersoorten optreedt. Daarbij verwijst ze naar een onderzoek van Vinokurov (1971). Het zou gaan om een analyse van meer dan 200 vogels. Waarom is bijvoorbeeld met dit onderzoek niet gerekend in het artikel in de DBA? (Dat artikel is trouwens al zwaar gestoeld op Europees onderzoek, net als dat van Burgers e.a.). Zou er meer Russisch onderzoek zijn waaruit een overgangszone blijkt?

Edit: hoewel de variatie ongrijpbaar blijft, heb ik maar weer eens wat koppen getekend.
Titel: Re: rietgans, again...
Bericht door: redmar_woudstra op februari 22, 2010, 10:51:51 am

De duidelijkste foto van middendorf 's die ik in mijn lijstje URL's heb staan, is deze: http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg (http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg)

Ook de foto's (met name de onderste) van Peter de Haas op Birdpix laten opvallend dikke, gebogen ondersnavels zien. De groep op één van zijn foto's is aardig homogeen qua kleurverdeling op de snavels. > http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=taigarietgans&personal_album=0 (http://www.birdpix.nl/album_search.php?search_type=pic_dutch_name&search=taigarietgans&personal_album=0)

Is die middendorf ook lichter of lijkt dat door de foto maar zo?
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 22, 2010, 11:20:40 am
De duidelijkste foto van middendorf 's die ik in mijn lijstje URL's heb staan, is deze: http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg (http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg)

Ik kan ook nog 2 links met (goede) foto's van Anser (fabalis) middendorffii toevoegen:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=15541 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=15541) (Korea, feb 2007);
http://www.flickr.com/photos/ken_san/316319689/sizes/l/ (http://www.flickr.com/photos/ken_san/316319689/sizes/l/) (Japan, december 2006).
 
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 22, 2010, 12:54:50 pm
Zie voor de Zweedse situatie een reactie van Heinicke; http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=zoek)

Zou toch wel fijn zijn als Heinicke ook z'n licht zou laten schijnen over die andere foto's van René Pop:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2273&page=zoek
http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2353&page=zoek

en nu maar de reacties van de Zweden afwachten....

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 22, 2010, 13:14:52 pm
Nog even een vraagje over het meten van vleugels. BWP geeft als ondergrens voor de vleugel-lengte van fabalis 434 mm (gebaseerd op 87 mannen en 73 vrouwen). Uit figuur 3 van Burgers et al. kun je opmaken dat zij onder 165 mannelijke en 172 vrouwelijke fabalis vogels geen individuen hadden met een vleugel-lengte onder de 415 mm. Ruokonen et al. hebben echter maar liefst 2 vogels met een vleugellengte onder de 415 mm en 4 met een vleugellengte onder de 434 mm in een sample van maar 16 fabalis vogels. Ik zal jullie niet vermoeien met nog zo'n plotje met kansdichtheden, maar  ook de vleugelmaten van de andere vogels zijn gemiddeld genomen erg (te) laag. Zou dat te verklaren zijn door een verandering in meet-methode?

Lützen
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 22, 2010, 14:06:08 pm
Nog even een vraagje over het meten van vleugels. BWP geeft als ondergrens voor de vleugel-lengte van fabalis 434 mm (gebaseerd op 87 mannen en 73 vrouwen). Uit figuur 3 van Burgers et al. kun je opmaken dat zij onder 165 mannelijke en 172 vrouwelijke fabalis vogels geen individuen hadden met een vleugel-lengte onder de 415 mm. Ruokonen et al. hebben echter maar liefst 2 vogels met een vleugellengte onder de 415 mm en 4 met een vleugellengte onder de 434 mm in een sample van maar 16 fabalis vogels. Ik zal jullie niet vermoeien met nog zo'n plotje met kansdichtheden, maar ook de vleugelmaten van de andere vogels zijn gemiddeld genomen erg (te) laag. Zou dat te verklaren zijn door een verandering in meet-methode? Lützen
De vleugellengte meten kan natuurlijk op allerlei manieren & dat kan een deel van de verschillen verklaren. Daarnaast is er sprake van krimp. Burgers et al hebben levende vogels gemeten, Ruokonen et al vooral (stok)oude museumvogels. Maar die zijn in de loop van de tijd gekrompen en daar moet je dus rekening mee houden (vooral van belang bij grote vogels als ganzen). Zie dé klassieke publicatie hierover: Engelmoer, Roselaar & Boere 1983. Post-mortem changes in measurements of some waders, Ringing & Migration 4: 245-249. Helaas (nog?) niet online, zie bv http://www.bto.org/ringing/rmj/rmj-issues.htm (http://www.bto.org/ringing/rmj/rmj-issues.htm)
 
(...). Nog wat anders. Ik las gisteren nog even in het stuk van Rogacheva (1992). Zij heeft het wel over een zone waar hybridisatie van drie ondersoorten optreedt. Daarbij verwijst ze naar een onderzoek van Vinokurov (1971). Het zou gaan om een analyse van meer dan 200 vogels. Waarom is bijvoorbeeld met dit onderzoek niet gerekend in het artikel in de DBA? (Dat artikel is trouwens al zwaar gestoeld op Europees onderzoek, net als dat van Burgers e.a.). Zou er meer Russisch onderzoek zijn waaruit een overgangszone blijkt?
hoi Albert,
 
scherp opgemerkt! Maar dat geldt natuurlijk voor bijna de hele discussie. We hebben het vooral over vogels in de niet-broedgebieden en proberen daar namen aan vast te plakken. De 'grote meeuwenmensen' zitten daar ook voortdurend mee te worstelen. Tja, Sangster & Oreel noemen een hele rij argumenten dat de 'hybridisatiezone', het 'overgangsgebied' etc. niet bestaat / een illusie is etc., maar komen dus ook niet op de proppen met informatie uit de broedgebieden zelf. Mede daarom is de bron Rogacheva nuttig. Dankzij geld van de Duitse overheid en van de Duitse WWF kun je dit nu lezen!
Geen idee waarom Sangster & Oreel dit boek niet in hun lijst met referenties hebben opgenomen en hier hun oordeel over uitspreken. Het boek was toen volop verkrijgbaar (in Duitsland gedrukt & uitgegeven). Ik ben wel eens op bijeenkomsten geweest waar er stapels van lagen. Ander probleem kan zijn (maar staat niet vermeld) dat Vinokurov zich baseerde op indeling in snavelkleuren; iets waarvan Sangster & Oreel zeggen dat dit niet veel zegt. Wel staat natuurlijk de onderzoekslocatie Ust-Tareya (73.15 N, 90.45 O) precies aangegeven (kenmerkend voor een degelijke avifauna).
 
De bron is voluit: "Vinokurov A.A. 1971. Vertebrate fauna of the Taymyr Station area (western Taymyr). In: Biogeocenoses of the Taymyr tundra and their productivity. Nauka Publishers, Leningrad, pagina 212-231." Is dus in het Russisch (titel is vertaald) en -kennelijk- een hoofdstuk van een boek ofzo.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 22, 2010, 15:27:16 pm
De vleugellengte meten kan natuurlijk op allerlei manieren & dat kan een deel van de verschillen verklaren. Daarnaast is er sprake van krimp. Burgers et al hebben levende vogels gemeten, Ruokonen et al vooral (stok)oude museumvogels. Maar die zijn in de loop van de tijd gekrompen en daar moet je dus rekening mee houden (vooral van belang bij grote vogels als ganzen). Zie dé klassieke publicatie hierover: Engelmoer, Roselaar & Boere 1983. Post-mortem changes in measurements of some waders, Ringing & Migration 4: 245-249. Helaas (nog?) niet online, zie bv http://www.bto.org/ringing/rmj/rmj-issues.htm (http://www.bto.org/ringing/rmj/rmj-issues.htm)

Bedankt, dat zal het waarschijnlijk wel wezen. Toevallig is de vogel met de kortste vleugel (394 mm) het enige vrij recent verzamelde individu (2002). De andere 15 zijn echter inderdaad allemaal van voor 1937.
 
Lützen
Titel: Re: rietgans, again...
Bericht door: Thijs Fijen op februari 22, 2010, 20:23:58 pm
Wat vinden jullie van deze? Landde in zijn eentje tussen de brandjes gisteren op Schiermonnikoog..
Titel: Re: rietgans, again...
Bericht door: Thijs Fijen op februari 22, 2010, 20:25:57 pm
En nog deze foto's (waaronder een algemene indruk foto)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 22, 2010, 22:18:29 pm
Bedankt, dat zal het waarschijnlijk wel wezen. Toevallig is de vogel met de kortste vleugel (394 mm) het enige vrij recent verzamelde individu (2002). De andere 15 zijn echter inderdaad allemaal van voor 1937.Lützen
Ja, maar je blijft zitten met het probleem dat je niet weet hoe zeker de broedstatus is. Burgers et al deden het volgende voor hun prachtige figuur 6: scherpe datumgrenzen stellen (26 mei - 30 juni) en alleen terugmeldingen gebruiken van vers dode vogels (zal dus meestal wel 'geschoten' zijn). En zie, er tekent zich een geweldig patroon af. Nogmaals, je weet dan nog steeds niet 100% zeker of het broedvogels zijn, maar het patroon spreekt boekdelen en is ecologisch flink doordacht. En er staan een heleboel stippen op de kaart, dus (geavanceerde) statistiek toepassen is overbodig.
 
Doe hetzelfde maar eens met alle 146 monsters (49 FAB, 37 SER, 39 MID en 21 ROS). Wat blijft over als je heel simpel dezelfde datumgrenzen toepast: 13 FAB, 5 SER, 1 MID en 7 ROS. Dan heb ik dus gewoon alles eruit gegooid waar ňf geen datum bijstaat, ňf een datum buiten de datumgrenzen (26 mei - 30 juni kun je natuurlijk ook wel over twisten of het juist is). Deze 26 vogels (i.p.v. 146) hebben dus net zo'n zekere broedstatus als de vogels in figuur 6 van Burgers et al. Maar heb je dan nog wel een genetisch verhaal? Het hele deel over middendorffii wordt in ieder geval wel wat dunnetjes met n = 1. Mijn goede vriend G. weet slechts één link te vinden met 'Verkneimbatsk'.
 
Groetjes, Klaas
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 23, 2010, 10:19:28 am
De duidelijkste foto van middendorf 's die ik in mijn lijstje URL's heb staan, is deze: http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg (http://www.birdingintaiwan.org/gallery/pen%20shing/gallery%202/Bean%20Goose1.jpg)

Ik kan ook nog 2 links met (goede) foto's van Anser (fabalis) middendorffii toevoegen:
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=15541 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=15541) (Korea, feb 2007);
http://www.flickr.com/photos/ken_san/316319689/sizes/l/ (http://www.flickr.com/photos/ken_san/316319689/sizes/l/) (Japan, december 2006).

En mocht iemand nog een keer een rietgans met gele halsband P51-P71 tegenkomen:

http://birdsmongolia.blogspot.com/2007/08/alert-colour-marking-of-swans-and-geese.html

Lützen
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 23, 2010, 18:14:39 pm
En mocht iemand nog een keer een rietgans met gele halsband P51-P71 tegenkomen:
Lützen
Ook in Japan zijn en Rusland (oostelijke deel) zijn tussen 1981 en 2002 totaal 1354 "rietganzen" met halsbanden uitgerust, zie: http://www.jawgp.org/manual/bandallj.htm (http://www.jawgp.org/manual/bandallj.htm). waarnemingen van deze vogels zijn gedaan in Japan, China en Korea (waarschijnlijk Zuid-Korea) zie: http://www3.alpha-net.ne.jp/users/jbbajbba/GANCRENG.htm (http://www3.alpha-net.ne.jp/users/jbbajbba/GANCRENG.htm)
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 23, 2010, 19:15:14 pm
In 1983 is er in Japanse tijdschrift Tori (de voorloper van het huidige Japanese Journal of Ornithology) een artikel verschenen over de herkenning van de (onder)soorten serrirrostris en middendorffii. Daar kwam men na biometrisch onderzoek tot de conclusie dat:
 
Methode 1: Indien "lengte van de bovensnavel/lengte van de kop" is meer dan 1 dan is het een middendorffii, indien uitkomst minder dan 1 dan is het een serrirostris.
Methode 2: Indien "lengte van de bovensnavel/snavelhoogte aan de basis" is meer dan 2 dan is het een middendorffii, indien uitkomst minder dan 2 dan is het een serrirostris.
 
Deze methode is getoetst in het veld en bleek in de praktijk bruikbaar. Zo'n soort artikel zou op deze manier wellicht ook voor de europese tegenhangers rossicus en fabalis gemaakt kunnen worden. Waarschijnlijk zijn de verschillen tussen middendorffii en serrirostris echter uitgesprokener dan tussen rossicus en fabalis en valt het in de praktijk nog tegen om het determinatieprobleem op deze manier op te lossen.
 
Het Japanse artikel is te downloaden via: http://www.journalarchive.jst.go.jp/english/jnlabstract_en.php?cdjournal=jjo1915&cdvol=32&noissue=2-3&startpage=95 (http://www.journalarchive.jst.go.jp/english/jnlabstract_en.php?cdjournal=jjo1915&cdvol=32&noissue=2-3&startpage=95)
 
 
 
 
 
Titel: Re: rietgans, again...
Bericht door: Cygnus op februari 23, 2010, 19:19:18 pm
En tot slot nog een foto van 2 in Japan gefotografeerde Anser serrirostris serrirostris:
http://www.shochian.com/blog/media/1/20080311-hishikui06.jpg (http://www.shochian.com/blog/media/1/20080311-hishikui06.jpg)
Vogels dus met een hele korte snavel.
 
 
Titel: Re: rietgans, again...
Bericht door: redmar_woudstra op februari 23, 2010, 19:39:45 pm
Maar wel met hoge snavelbasis, of lijkt dat maar zo. Hogere snavelbasis dan rossicus lijkt me.
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 23, 2010, 23:05:45 pm
De Rietganzengroep beschrijf historie is een interessante, vol met vogels uit wintergebieden, en waar het grootste deel niet meer terug te vinden is in musea, en of beschrijvingen.

1). Zoals eerder gesteld heeft Latham in zijn synopsis 1787 de soort fabalis genoemd, met als opmerking (volgens Hartert); Groot-Brittanie, Angabe vom Bruten auf den Hebriden irrig, ebenso die vom Vorkommen in Amerika), vogels is niet bewaard gebleven, net zo min als een beschrijving. Weer een wintervogel.... Overigens had Latham hem weer van een samengestelde vogel uit Pennant 1770 & 1776.

2). Volgens naamgeving wat van Gmelin in 1789 idem als bovenstaande, echter nu segetum genoemd, ook geen vogel bewaard gebleven. Weer een wintervogel....

3). Hierna beschrijf Brehm een vogel in 1822 van Gotha beschreven als rufescens. Deze vogel is niet aanwezig in AMNH en ZFMB. Weer een wintervogel....

4). Brehm beschrijft in 1830 de platyuros van de Pommertische Kust, ook deze vogel is nu nergens meer aanwezig. Weer een wintervogel....

5). Brehm opnieuw beschrijft in 1830 de arversis, van Duitsland, maar ook geen exemplaar beschikbaar. Weer een wintervogel....

6). De leukonyx van Selys Longchamps volgt in 1855 van Belgie, maar ook deze vogel weet ik nu ff niet te vinden? Brussel wellicht? Weer een wintervogel....

7). Hierna beschrijft Strickland een vogel uit Engeland, en noemt deze paludosus in 1858. Weet niet waar deze vogel zich bevind, mogelijk in Cambridge. Weer een wintervogel....

 8) . Parker beschrijft in 1863 palustris van Engeland. Weer een wintervogel.... en niet te vinden tot heden.

9). Swinhoe beschrijft in 1871 de serrirostris van Amoy, China. Locatie type onbekend.

10). Hierna wordt middendorfii beschreven door Sewertszow van Turkestan (Kazakhstan) in 1873. Vogel (type) vermoedelijk in Moskou, wel weer in wintervogel.

11). Suskin beschrijft in 1895 van Oost-Rusland neglectus (Ufa).

12). Oates beschrijft in 1899 mentalis van Yokohama, Japan. Type in BMNH.

13). Buturlin beschrijft eindelijk eens een broedgebied vogel en wel van Psovaia i Ruzheinaia Qkhota in 1901 en beschrijf deze als carneirostris. Deze plek in de zuidelijke oeral is wellicht de juiste basis en naamgeving voor de ganzen welke we hier verkrijgen.....

14). Rickett beschrijft in 1901 van Fokien, China de winterende oatesi.

15). Buturlin beschrijft in 1901 carneirostris van Nova Zembla.

16). Alpheraky 1905 beschrijft van de Taimyr sibiricus. Dus een broedvogel.

17). Buturlin beschrijft in 1908 van Pascha Ochota anadyrensis. Dus ook een broedvogel.

Meer informatie staat (helaas nu niet beschikbaar bij me) in The Ibis 1944 pagina 87-88, The Ibis 1947: pagina 272-275 & 354-355 en in Bannerman. The Birds of The British Islands . Volume zes. Pagina 224-233.

Eigenlijk lijkt me de naamgeving niet correct en verwarrend, en zal wellicht het e.e.a. opnieuw voorglegd dienen te worden bij de IUZN.

Noot: De onovertroffen Cramp heeft bijvoorbeeld maten opgenomen van vogels uit Nederland, en hier staat het tot ondersoort/soort gedetermineerd, maar wat hadden ze nu echt in handen....
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 25, 2010, 13:18:27 pm
Nuttig overzicht Justin, en erg jammer dat die beschrijvingen niet te vinden zijn. Bevestigd bij mij wel het idee dat er maar weinig objectieve criteria zijn waarop deze (onder)soorten kunnen worden onderscheiden. Ben daarom wel benieuwd wat jullie nu vinden van het commentaar van Thomas Heinicke op de DB site:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=1

Zijn dit nu echt andere vogels dan het individu op de achtergrond en op bijv. die andere foto:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2273&page=1

Of denken jullie dat het allemaal "gewoon" Toendra’s zijn?

Lützen

Een paar van de vele oranjesnavelige vogels van gisteren:
http://waarneming.nl/fotonew/9/1073239.jpg

en kan deze nek nog?
Titel: Re: rietgans, again...
Bericht door: maartenwielstra op februari 25, 2010, 19:53:31 pm
Die oranjesnavelige 'toendrasnavels' doen me denken aan de volgende vogels:
 
http://waarneming.nl/user/photos/3166?q=taigarietgans&from=1980-01-01&to=2010-02-25&g=0&sex= (http://waarneming.nl/user/photos/3166?q=taigarietgans&from=1980-01-01&to=2010-02-25&g=0&sex=)
 
 
Nuttig overzicht Justin, en erg jammer dat die beschrijvingen niet te vinden zijn. Bevestigd bij mij wel het idee dat er maar weinig objectieve criteria zijn waarop deze (onder)soorten kunnen worden onderscheiden. Ben daarom wel benieuwd wat jullie nu vinden van het commentaar van Thomas Heinicke op de DB site:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=1 (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2272&page=1)

Zijn dit nu echt andere vogels dan het individu op de achtergrond en op bijv. die andere foto:

http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2273&page=1 (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=8&fid=2273&page=1)

Of denken jullie dat het allemaal "gewoon" Toendra’s zijn?

Lützen

Een paar van de vele oranjesnavelige vogels van gisteren:
http://waarneming.nl/fotonew/9/1073239.jpg (http://waarneming.nl/fotonew/9/1073239.jpg)

en kan deze nek nog?
Titel: Re: rietgans, again...
Bericht door: lupokatja op februari 26, 2010, 10:42:51 am
Die oranjesnavelige 'toendrasnavels' doen me denken aan de volgende vogels:
http://waarneming.nl/user/photos/3166?q=taigarietgans&from=1980-01-01&to=2010-02-25&g=0&sex= (http://waarneming.nl/user/photos/3166?q=taigarietgans&from=1980-01-01&to=2010-02-25&g=0&sex=)

Precies, vroeg me al af of de waarnemers in Sassenheim al wisten dat ze naar een stel Toendrarietganzen hadden staan kijken:

http://waarneming.nl/soort/view/338?from=2006-01-01&to=2007-03-31&species=338&prov=9&akt=0&maand=0&from=2007-03-01&to=2007-03-31&maand=0&prov=9 (http://waarneming.nl/soort/view/338?from=2006-01-01&to=2007-03-31&species=338&prov=9&akt=0&maand=0&from=2007-03-01&to=2007-03-31&maand=0&prov=9)

Citaat van Arnoud van den Berg op de DB-site:
Afgelopen jaren foto's gemaakt van rieten die eerst als Taiga en maanden later als Toendra werden gedetermineerd. Voorbeelden zijn Sassenheim in maart 2007 (foto's in webarchief) en Ulicoten in 2002/03.


Waarneming van Peter Meininger zou in dat geval trouwens ook op onzeker mogen:
http://waarneming.nl/waarneming/view/46474229 (http://waarneming.nl/waarneming/view/46474229)

Nog maar eens wat rietganzen met discusssie uit Zweden:
http://www.artportalen.se/artportalen/gallery/Image.aspx?rappsyst=0&obsID=10542919&imageID=55468 (http://www.artportalen.se/artportalen/gallery/Image.aspx?rappsyst=0&obsID=10542919&imageID=55468)

Ik ben bereid elke verklaring te accepteren die een beetje recht doet aan de variatie die je in het veld (en op het web) kunt zien, maar zelfs het commentaar van Thomas Heinicke (waarvan ik vermoed dat ie meer Taigarietganzen ziet in een maand dan ik in mijn hele leven) kan me nog niet echt overtuigen. Ik vind het prima dat iedereen zo zijn eigen definities van Taiga en Toendra hanteert, maar ik zou wel eens willen weten of er ook objectief onderzoek aan ten grondslag ligt of dat men maar wat roept. Natuurlijk zie ik duidelijk verschil tussen dit soort vogels en die uit Groningen, maar of en wat dat betekent....?

Lützen

Titel: Re: rietgans, again...
Bericht door: maartenwielstra op februari 27, 2010, 13:13:02 pm
http://aller-voegel.de/Vgel2.html (http://aller-voegel.de/Vgel2.html)
 
In de gallery winter 09-10 staan nog wat Taiga's.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op februari 28, 2010, 22:12:25 pm
Ik ben bereid elke verklaring te accepteren die een beetje recht doet aan de variatie die je in het veld (en op het web) kunt zien, (...) maar ik zou wel eens willen weten of er ook objectief onderzoek aan ten grondslag ligt of dat men maar wat roept. (...) Lützen
hoi Lützen,
 
Goed onder woorden gebracht, want hier draait het uiteindelijk wel om. Tot nu toe niets vernomen van de grote rij 'believers' / 'rekkelijken' die jaar in jaar uit in de Sovon-rapporten tot de conclusie komen dat er steevast duizenden Taigarietganzen in Nederland overwinteren. Jij wel? Of iemand anders? En hoe moet ik dit stilzwijgen interpreteren? Er stond een tijdje geleden een stukje hierover op de site van Sovon (bij de rubriek 'nieuws'), maar dat kan ik niet meer terugvinden.
 
Een duidelijk artikel schrijven voor Limosa kan ook. Gewoon de hele rij getallen vanaf pakweg 2000 uit alle Sovon-rapporten & wat andere (regionale) publicaties op een rij zetten en, net zoals in de Avifauna van Limburg, dit alles kritisch bekijken. En met duidelijke recente foto's en een kort stukje over de huidige stand van zaken m.b.t. herkenning. Zoiets is m.i. ook wel eens met broedgevallen van Matkop <---> Glanskop gebeurd? Wat wel zeker is dat de redactie van Limosa staat te springen om dit soort kopij.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op februari 28, 2010, 22:14:37 pm
Moi Klaas,

Ik geloof dat je al een mogelijk goed artikel in handen hebt! Ik lees het graag!

Groet, Justin
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op maart 05, 2010, 19:42:23 pm
Moi Klaas, ik geloof dat je al een mogelijk goed artikel in handen hebt! Ik lees het graag! Groet, Justin
Hmmm, ik weet niet of ik wel het juiste persoon ben om zo'n artikel te schrijven. Per slot van rekening weet ik nauwelijks iets van Rietganzen af & ik zie ze ook bijna nooit. Maar er lijkt toch duidelijk wat beweging te zijn bij het 'Sovon-front' / de 'believers.' Vandaag kreeg ik de nieuwste Sovon Nieuwsbrief van de watervogeltellingen (nr 7, maart 2010) en daarin schrijft Berend Voslamber het volgende:
 
"En dan de Taigarietgans. De situatie is niet duidelijk. Er zijn een paar zekere vogels gezien in Zeeuws-Vlaanderen. Maar grote aantallen, zoals die in eerdere strenge winters werden vastgesteld, zijn nergens gemeld."
 
Uiteindelijk is het natuurlijk een kwestie van knopen doorhakken bij Sovon & haar (halve?) zuster de Sovon Ganzen- en Zwanenwerkgroep. Geloof blijven hechten aan tellers die jarenlang honderen / duizenden Taigarietganzen op tellijsten hebben gezet / digitaal op de Sovon site hebben ingevoerd, of hier geen geloof meer aan hechten (en ook met terugwerkende kracht). En ik kan me best voorstellen dat er momenteel een flinke strijd hierover plaatsvindt binnen Sovon & haar (halve?) zusterorganisatie. Want Leo van den Berg zit ook in de Sovon Ganzen- en Zwanenwerkgroep en is ook auteur van die stapel wavo-rapporten met duizenden Taigarietganzen. Knopen doorhakken zal ongetwijfeld een flinke ruzie / onenigheid opleveren. En dan is doormodderen soms helemaal niet zo raar.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Cygnus op maart 05, 2010, 20:58:16 pm
Vandaag kreeg ik de nieuwste Sovon Nieuwsbrief van de watervogeltellingen (nr 7, maart 2010) ...
Te downloaden via: http://www.sovon.nl/pdf/watervogeltellingen_2010_3.pdf (http://www.sovon.nl/pdf/watervogeltellingen_2010_3.pdf)
Naar aanleiding van het verhaaltje van Klaas ook nog even in eerdere watervogelnieuwsbrieven van SOVON gekeken. In het nummer van februari 2010 (http://www.sovon.nl/pdf/watervogeltellingen_2010_2.pdf (http://www.sovon.nl/pdf/watervogeltellingen_2010_2.pdf)) is al een interessant stukje over het "Taigarietganzenprobleem" geschreven, namelijk:
 
"Taigarietganzen is een verhaal apart. Het is aannemelijk dat door determinatieproblemen de aantallen in ons land (veel) te hoog worden ingeschat. Waarnemingen die met documentatie worden ingeleverd blijken vrijwel altijd Toendrarietganzen (die een grote variatie in postuur en snavelkleur, en -vorm hebben, bedenk bovendien dat grootte van mannen en vrouwen sterk kan verschillen). De grote aantallen die in de afgelopen winters in ons land werden geteld (maxima van gemiddeld rond de 4000 vogels) passen bovendien slecht in het internationale beeld. De totale populatie Taigarietganzen lijkt in de afgelopen decennia met bijna 40% afgenomen en de vogels concentreren zich steeds meer in de kern-overwinteringsgebieden in Zweden en het uiterste noordoosten van Duitsland. In koudere winters komt nauwelijks vorsttrek op gang, wat ook de geringe aantallen die nu in Nederland worden gemeld bevestigen. In Denemarken en in het westen van Duitsland wordt al jaren een afname vastgesteld. In het maart-nummer van SOVON-Nieuws zullen we nader op deze problematiek ingaan. Duidelijk is eveneens dat het hoog tijd wordt voor een goed determinatiewerk."
 
Er wordt een stukje over dit onderwerp in SOVON-nieuws van deze maand aangekondigd. Ben erg benieuwd naar de inhoud. 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op maart 05, 2010, 21:37:27 pm
Te downloaden via: http://www.sovon.nl/pdf/watervogeltellingen_2010_3.pdf (http://www.sovon.nl/pdf/watervogeltellingen_2010_3.pdf) Naar aanleiding van het verhaaltje van Klaas ook nog even in eerdere watervogelnieuwsbrieven van SOVON gekeken. In het nummer van februari 2010 (http://www.sovon.nl/pdf/watervogeltellingen_2010_2.pdf (http://www.sovon.nl/pdf/watervogeltellingen_2010_2.pdf)) is al een interessant stukje over het "Taigarietganzenprobleem" geschreven.
hoi Trinus, zeer bedankt hiervoor. De Nieuwsbrief van februari krijg ik niet, want ik doe alleen maar mee met wadvogeltellingen. En die zijn niet in iedere maand (vaste maanden zijn januari, mei, september en november; maart is de wisselmaand). En inderdaad, al deze Nieuwsbrieven staan natuurlijk allemaal op de website van Sovon te lezen. Ik ben ook erg benieuwd naar het stuk in het komende nummer van Sovonnieuws. Gister trouwens ook nog een 2KJ Stormmeeuw met een moskva ring afgelezen; ben benieuwd waar die vandaan komt. Was voor mij de eerste keer om een Stormmeeuw met een moskva ring te zien (aluminium geval op de kop aan loopbeen).
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Cygnus op maart 06, 2010, 13:19:01 pm
Het hele deel over middendorffii wordt in ieder geval wel wat dunnetjes met n = 1. Mijn goede vriend G. weet slechts één link te vinden met 'Verkneimbatsk'.
Het zat me niet lekker dat ik deze plaats in eerste instantie ook niet kon vinden, inmiddels is het gelukt! De juiste naam moet zijn Verkhneimbatsk (in het russisch Верхнеимбатск), soms ook wel Verkhne-Imbatskoye (Верхне-Имбатское). Deze plaats ligt aan de Yenisey. Een link naar Google-maps: http://maps.google.com/maps?f=q&source=s_q&hl=nl&geocode=&q=63%C2%B0+8'30.92%22N++87%C2%B058'33.78%22E&sll=63.141329,87.970963&sspn=0.138979,0.438766&ie=UTF8&ll=63.141949,87.975769&spn=0.138976,0.438766&t=h&z=11 (http://maps.google.com/maps?f=q&source=s_q&hl=nl&geocode=&q=63%C2%B0+8'30.92%22N++87%C2%B058'33.78%22E&sll=63.141329,87.970963&sspn=0.138979,0.438766&ie=UTF8&ll=63.141949,87.975769&spn=0.138976,0.438766&t=h&z=11)
En nog een foto van het mooie rivierlandschap daar: http://onlinefast.org/gallery/displayimage.php?pid=482&fullsize=1 (http://onlinefast.org/gallery/displayimage.php?pid=482&fullsize=1)
Is dat ook weer opgelost.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op maart 16, 2010, 09:33:37 am
Het hele deel over middendorffii wordt in ieder geval wel wat dunnetjes met n = 1. Mijn goede vriend G. weet slechts één link te vinden met 'Verkneimbatsk'.
Het zat me niet lekker dat ik deze plaats in eerste instantie ook niet kon vinden, inmiddels is het gelukt! De juiste naam moet zijn Verkhneimbatsk (in het russisch Верхнеимбатск), soms ook wel Verkhne-Imbatskoye (Верхне-Имбатское). Deze plaats ligt aan de Yenisey. Een link naar Google-maps: http://maps.google.com/maps?f=q&source=s_q&hl=nl&geocode=&q=63%C2%B0+8'30.92%22N++87%C2%B058'33.78%22E&sll=63.141329,87.970963&sspn=0.138979,0.438766&ie=UTF8&ll=63.141949,87.975769&spn=0.138976,0.438766&t=h&z=11 (http://maps.google.com/maps?f=q&source=s_q&hl=nl&geocode=&q=63%C2%B0+8'30.92%22N++87%C2%B058'33.78%22E&sll=63.141329,87.970963&sspn=0.138979,0.438766&ie=UTF8&ll=63.141949,87.975769&spn=0.138976,0.438766&t=h&z=11)
En nog een foto van het mooie rivierlandschap daar: http://onlinefast.org/gallery/displayimage.php?pid=482&fullsize=1 (http://onlinefast.org/gallery/displayimage.php?pid=482&fullsize=1) Is dat ook weer opgelost.
Ik had dus beter gewoon eens even kunnen kijken in de Grote Times Wereldatlas, want daar staat Verkneimbatsk dus gewoon in! Zelfs op twee verschillende kaarten. Wordt daar 'Verkhneimbatskoye' genoemd. En in het boek van Rogacheva (1992, The Birds of Central Siberia) wordt de plaats ook vermeld. Coördinaten 63.05 N, 88.00 O. En het DNA-monster komt dus niet uit wat je het kerngebied zou noemen van de verspreiding van Middendorffs Rietgans. Afvoeren dus.
 
M.b.t. de analyse van de DNA monsters van Middendorffs Rietgans komt ik dan tot de conclusie dat er geen één voldoet aan criteria die bv de CDNA ook stelt aan 'broedvogels' (alleen zekere gevallen, zie Avifauna van Nederland, deel 1) en aan te accepteren waarnemingen (op de maand en op de provincie nauwkeurig bekend, ook voor oude museumgevallen). Het is me een volstrekt raadsel waarom de CDNA (George Sangster in litt) heeft besloten om Middendorffs Gans als aparte soort aan te merken. Zie ook bijgaande pdf met de argumentatie in DB 31, pagina 35-37, 2009. Mijn vermoeden / stelling is dat men (of George?) kennelijk alleen de samenvatting en de figuren van Ruokonen et al heeft gelezen / bekeken en de bijlage gemakshalve heeft overgeslagen.
 
Verder afgelopen weekend even een blik geworpen in de nieuwe Collins guide. Middendorffs Gans wordt niet eens genoemd, en Rietgans is nog steeds één soort (Anser fabalis), net als overigens Gele Kwikstaart. Heuglin's Meeuw wordt gezien als een ondersoort van de Kleine Mantelmeeuw (Larus fuscus), Amerikaanse Zilvermeeuw wordt wel gezien als een aparte soort. De auteurs van de Collins Guide leggen uit dat ze zelfstandig een afweging hebben gemaakt welke namen ze voor soorten / taxa gebruiken.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: lupokatja op april 08, 2010, 08:37:14 am
SOVON artikel is al weer een weekje online:

http://www.sovon.nl/pdf/Sonie20101.pdf

Voor de Nederlandse waarnemers wellicht nog interessant:
http://www.artportalen.se/artportalen/gallery/Image.aspx?rappsyst=0&obsID=18215877&imageID=200514

Lutzen
Titel: Re: rietgans, again...
Bericht door: HPM op april 08, 2010, 10:16:44 am
SOVON artikel is al weer een weekje online: http://www.sovon.nl/pdf/Sonie20101.pdf (http://www.sovon.nl/pdf/Sonie20101.pdf)
...
Lutzen

Koffijberg en Hornman maken in dat artikel dezelfde denkfout als hier al eerder
is gesignaleerd

   "Er gaan ook steeds weer stemmen op om, vanwege de determinatieproblemen,
    beide soorten maar als 'Rietgans' te beschouwen. Echter, dan zal nooit
    duidelijk worden hoe de populatie Taigarietganzen ervoor staat en zullen
    ook ontwikkelingen in aantallen en verspreiding slecht te achterhalen
    zijn. En die zijn belangrijk, want ze verschillen sterk tussen Taiga- en
    Toendrarietgans."

Als Taiga en Toendra niet goed zijn te onderscheiden worden ganzen verkeerd
benoemd en valt er dus ook niets betrouwbaars te zeggen over verspreiding,
aantallen en ontwikkeling en ook niets over de verschillen daarin.
Wat meet je als je een deel (of misschien wel alle) Zanglijsters als Koperwiek
gaat benoemen?

--
Groeten, Herman van der Meer
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op april 08, 2010, 10:34:52 am
De in het verleden getelde aantallen worden blijkbaar nog steeds als heilig gezien.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op april 09, 2010, 14:03:49 pm
De in het verleden getelde aantallen worden blijkbaar nog steeds als heilig gezien.
Yep, maar niet in de provincie Limburg hoor.
 
De auteurs van de 'Avifauna van Limburg' (Fred Hustings, Jo van der Coelen, Boena van Noorden, Ran Schols en Paul Voskamp) hebben korte metten gemaakt met alle niet cq. onvoldoende gedocumenteerde gevallen van Taigarietgans in Limburg van na 2000.
 
Tegelijk blijf ik het opvallend vinden dat de conclusies van deze degelijke bron maar steeds niet wordt vermeld in de Sovon-publicaties over dit onderwerp, onder andere in het juist uitgekomen wavo-rapport over het seizoen 2007/08 http://www.sovon.nl/pdf/Mon2009-02wavorap.pdf (http://www.sovon.nl/pdf/Mon2009-02wavorap.pdf) en op zaterdag 3 april jl. bij de tellers in de brievenbus. Dezelfde Fred Hustings is eerste auteur van dit wavo-rapport er er staat toch echt een seizoensmaximum in van naar schatting 4200 getelde Taigarietganzen in januari 2008. En het vage histogram (wat zijn nu 'gemiddeld 3000 Taigarietganzen in een seizoen van 12 maanden'?) op pagina 51 maakt niet kenbaar dat er twijfels over de getallen zijn (de tekst wel). Ook in de digtale bijlage http://www.sovon.nl/pdf/Mon2009-02wavorap_webbijlagen.pdf (http://www.sovon.nl/pdf/Mon2009-02wavorap_webbijlagen.pdf) staat niet met sterretjes o.i.d. aangegeven dat er (ernstige) twijfel is over de aantallen Taigarietganzen.
 
Tegelijkertijd (dus ook op zaterdag 3 april 2010) kwam ook de nieuwste aflevering van Dutch Birding uit de brievenbus. Met een totaal ander beeld: "Ondanks het strenge winterweer bleef het aantal overtuigend gedocumenteerde Taigarietganzen beperkt tot enkele tientallen (of moeten we zeggen: Dankzij het strenge winterweer kwam het aantal overtuigende Taigarietganzen op enkele tientallen?)."
 
Herman, je hebt volkomen gelijk. En is het gewoon niet de waarheid dat Taiga- en Toendrarietgans gewoon niet goed cq. onvoldoende zeker van elkaar zijn te onderscheiden (net zoals IJslandse Grutto en Grutto in de wintergebieden en in winterkleed)? Wat zijn ook alweer de criteria om soorten te onderscheiden? Ze staan in
http://www3.interscience.wiley.com/journal/118907781/abstract?CRETRY=1&SRETRY=0 (http://www3.interscience.wiley.com/journal/118907781/abstract?CRETRY=1&SRETRY=0)
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: George Sangster op april 10, 2010, 20:38:53 pm
Klaas van Dijk schreef op maart 16, 2010, 09:33:37 am:

"Het is me een volstrekt raadsel waarom de CDNA (George Sangster in litt) heeft besloten om Middendorffs Gans als aparte soort aan te merken. Zie ook bijgaande pdf met de argumentatie in DB 31, pagina 35-37, 2009. Mijn vermoeden / stelling is dat men (of George?) kennelijk alleen de samenvatting en de figuren van Ruokonen et al heeft gelezen / bekeken en de bijlage gemakshalve heeft overgeslagen."

Dit is niet alleen flauw, maar vooral onjuist.

middendorffii is gesplitst door de redactie van Dutch Birding, en niet door de CDNA, noch de CSNA. De CDNA beslist overigens niet over taxonomie.

In de redactiemededeling in Dutch Birding wordt ik geciteerd over de implicaties van het artikel van Ruokonen et al. voor de split van A. fabalis vs. A. serrirostris.

De CSNA heeft nog geen standpunt ingenomen over middendorffii. Het (zwakke) artikel van Ruokonen c.s. is binnen de CSNA ter sprake gekomen, maar meer niet.

Als de CSNA iets beslist dan wordt dat in een officieel verslag in Ardea gepubliceerd.

Groeten,
George Sangster
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op april 11, 2010, 11:12:04 am
Klaas van Dijk schreef op maart 16, 2010, 09:33:37 am:"Het is me een volstrekt raadsel waarom de CDNA (George Sangster in litt) heeft besloten om Middendorffs Gans als aparte soort aan te merken. Zie ook bijgaande pdf met de argumentatie in DB 31, pagina 35-37, 2009. Mijn vermoeden / stelling is dat men (of George?) kennelijk alleen de samenvatting en de figuren van Ruokonen et al heeft gelezen / bekeken en de bijlage gemakshalve heeft overgeslagen."
 
Dit is niet alleen flauw, maar vooral onjuist. Middendorffii is gesplitst door de redactie van Dutch Birding, en niet door de CDNA, noch de CSNA. De CDNA beslist overigens niet over taxonomie. In de redactiemededeling in Dutch Birding wordt ik geciteerd over de implicaties van het artikel van Ruokonen et al. voor de split van A. fabalis vs. A. serrirostris. De CSNA heeft nog geen standpunt ingenomen over middendorffii. Het (zwakke) artikel van Ruokonen c.s. is binnen de CSNA ter sprake gekomen, maar meer niet. Als de CSNA iets beslist dan wordt dat in een officieel verslag in Ardea gepubliceerd. Groeten, George Sangster
hoi George,
 
Excuses dat ik hierboven jouw naam noemde. Ik was in verwarring gebracht door de eerste zin van dit artikel in DB (zie bijgevoegde pdf). Had over het hoofd gezien dat er een onderscheid moet worden gemaakt tussen soorten / ondersoorten die in Nederland zijn gezien en soorten / ondersoorten die (nog) niet in Nederland zijn gezien. Maar er zijn diverse recente artikelen van de hand van Leo van den Bergh waarbij hij wijst op het regelmatig voorkomen van Middendorffs Gans in Nederland en er zijn ook een aantal oudere gevallen. Dus Middendorffs Gans staat dan toch allang (in potentie?) op de Nederlandse lijst? Of maken jullie (=CSNA) onderscheid tussen soorten en ondersoorten? Maar waarom wordt dan in de eerste zin van het artikel in DB (zie pdf) het woord 'taxa' gebruikt, en niet het woord 'soort'?
 
Excuses dat ik CDNA, CSNA en de redactie van Dutch Birding op één hoop gooide. Anderzijds zitten drie van de vier leden van de CSNA (Arnoud, André en Kees Roselaar) ook in de redactie van Dutch Birding. Lees ik tussen de regels door dat jij het niet eens bent met hun beslissing om Middendorffs Gans als aparte soort te beschouwen?
 
George, wat staat er eigenlijk in de bron 'George Sangster in litt'? Want eerder in deze draad hebben diverse mensen (m.i. terecht!) uiteengezet dat Ruokonen et al concluderen dat Taigarietgans en Toendrarietgans niet langer als twee soorten beschouwd kunnen worden. Jij hebt hier dus een andere mening over. Maar hoe verhoudt deze mening zich dan met de mening van de George Sangster die auteur is van diverse taxonomische mededelingen van de BOU waarbij juist de conclusie wordt getrokken dat Taigarietgans en Toendrarietgans géén twee soorten zijn? We hebben het toch over één en dezelfde George Sangster? En hoe kijk je eigenlijk aan tegen (de auteurs van) de nieuwste druk van de Collins Guide? Want ook daar worden Toendrarietgans en Taigarietgans nog steeds (of weer?) als één soort beschouwd.
 
Vriendelijke groeten en alvast bedankt voor een inhoudelijke reactie,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op april 12, 2010, 13:42:51 pm
Overigens, is het BW artikel dat hier genoemd wordt wat? http://www.birdforum.net/showthread.php?t=114631 Waarom wordt deze taxonomie gehanteerd?
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op april 16, 2010, 22:06:29 pm
SOVON artikel is al weer een weekje online: http://www.sovon.nl/pdf/Sonie20101.pdf (http://www.sovon.nl/pdf/Sonie20101.pdf) Lutzen
Koffijberg en Hornman maken in dat artikel dezelfde denkfout als hier al eerder is gesignaleerd

   "Er gaan ook steeds weer stemmen op om, vanwege de determinatieproblemen,
    beide soorten maar als 'Rietgans' te beschouwen. Echter, dan zal nooit
    duidelijk worden hoe de populatie Taigarietganzen ervoor staat en zullen
    ook ontwikkelingen in aantallen en verspreiding slecht te achterhalen
    zijn. En die zijn belangrijk, want ze verschillen sterk tussen Taiga- en
    Toendrarietgans."

Als Taiga en Toendra niet goed zijn te onderscheiden worden ganzen verkeerd benoemd en valt er dus ook niets betrouwbaars te zeggen over verspreiding, aantallen en ontwikkeling en ook niets over de verschillen daarin. Wat meet je als je een deel (of misschien wel alle) Zanglijsters als Koperwiek gaat benoemen? 
Groeten, Herman van der Meer
Tja..... en waarom willen mensen in erg veel andere landen er - kennelijk- niet aan om Taigarietgans en Toendrarietgans als twee aparte soorten te beschouwen? Ook de auteurs van de gloednieuwe Collins gids vonden -kennelijk- onvoldoende argumenten om Rietgans te splitsen in twee soorten.
 
Verder staan ondertussen een hele rij nieuwe foto's met determinatiekenmerken op de site van Sovon, zie http://www.sovon.nl/default.asp?id=877 (http://www.sovon.nl/default.asp?id=877) en zie ook http://www.sovon.nl/pdf/Rietganzencomplex.pdf (http://www.sovon.nl/pdf/Rietganzencomplex.pdf)
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: lupokatja op april 26, 2010, 10:11:04 am
Overigens, is het BW artikel dat hier genoemd wordt wat? http://www.birdforum.net/showthread.php?t=114631 (http://www.birdforum.net/showthread.php?t=114631) Waarom wordt deze taxonomie gehanteerd?
Ik krijg mijn nummer van Birding World altijd pas halverwege de maand, dus lag dit pas afgelopen weekend in de bus. Best een leuk artikel, maar nogal gefocused op de UK en het gros van de foto’s is ook op internet te zien (en vrijwel alle foto’s van Taigarietganzen zijn van het groepje dat deze winter op de Shetland eilanden zat).

Over taxonomie zegt Dan Brown het volgende:

… so it would seem that the most expeditious treatment for now is to regard Taiga and Middendorff’s Bean Geese as separate monotypic species (…) and Tundra Bean Goose as a polytypic species comprising two very similar forms (…). In addition, the name ‘johanseni’ could be usefully retained to describe those individuals that may originate from the contact zone between A. fabalis and A. middendorffii and that are not easily assigned to either of these two taiga-breeding species. Indeed, as it was originally described as a subspecies that looked somewhat intermediate between, and nested between, these two long-billed forms, might the poorly known ‘johanseni’ always have been a hybrid population?

Dit is zelf weer een hybride van CSNA/Ruokonen en er ligt verder geen eigen onderzoek of speciale expertise aan ten grondslag (wordt ook niet gepretendeerd), dus veel status heeft het wat mij betreft niet.


Als Taiga en Toendra niet goed zijn te onderscheiden worden ganzen verkeerd benoemd en valt er dus ook niets betrouwbaars te zeggen over verspreiding, aantallen en ontwikkeling en ook niets over de verschillen daarin. Wat meet je als je een deel (of misschien wel alle) Zanglijsters als Koperwiek gaat benoemen? 
  Groeten, Herman van der Meer

Dit vind ik dan wel weer heel kort door de bocht. We tellen toch ook de IJslandse Grutto's van Klaas? Het ligt er natuurlijk maar net aan wat je met die telling wilt en hoe (on)betrouwbaar ze zijn.

 
De auteurs van de 'Avifauna van Limburg' (Fred Hustings, Jo van der Coelen, Boena van Noorden, Ran Schols en Paul Voskamp) hebben korte metten gemaakt met alle niet cq. onvoldoende gedocumenteerde gevallen van Taigarietgans in Limburg van na 2000.

 
Dan kies je dus voor hoge specificiteit (elke getelde Taigarietgans is er ook een) en een vooralsnog onbekende (maar mogelijk lage) sensitiviteit (je mist wellicht veel Taigas). Het is nog maar de vraag of je daarmee een goed inzicht krijgt in de verspreiding. Als ik het voorbeeld van de IJslandse Grutto's nog maar eens mag gebruiken; ik heb niet het idee dat een goed inzicht in het relatieve aandeel cq. de verspreiding van IJslandse Grutto's er bij gebaat is dat alleen 100% zekere zomerkleed mannetjes als zodanig gemeld worden.
 
 
Lutzen
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op april 27, 2010, 15:54:20 pm
SOVON artikel is al weer een weekje online: http://www.sovon.nl/pdf/Sonie20101.pdf (http://www.sovon.nl/pdf/Sonie20101.pdf) Lutzen
Koffijberg en Hornman maken in dat artikel dezelfde denkfout als hier al eerder is gesignaleerd

   "Er gaan ook steeds weer stemmen op om, vanwege de determinatieproblemen,
    beide soorten maar als 'Rietgans' te beschouwen. Echter, dan zal nooit
    duidelijk worden hoe de populatie Taigarietganzen ervoor staat en zullen
    ook ontwikkelingen in aantallen en verspreiding slecht te achterhalen
    zijn. En die zijn belangrijk, want ze verschillen sterk tussen Taiga- en
    Toendrarietgans."

Als Taiga en Toendra niet goed zijn te onderscheiden worden ganzen verkeerd benoemd en valt er dus ook niets betrouwbaars te zeggen over verspreiding, aantallen en ontwikkeling en ook niets over de verschillen daarin. Wat meet je als je een deel (of misschien wel alle) Zanglijsters als Koperwiek gaat benoemen? 
Groeten, Herman van der Meer
Tja..... en waarom willen mensen in erg veel andere landen er - kennelijk- niet aan om Taigarietgans en Toendrarietgans als twee aparte soorten te beschouwen? Ook de auteurs van de gloednieuwe Collins gids vonden -kennelijk- onvoldoende argumenten om Rietgans te splitsen in twee soorten.
 
Verder staan ondertussen een hele rij nieuwe foto's met determinatiekenmerken op de site van Sovon, zie http://www.sovon.nl/default.asp?id=877 (http://www.sovon.nl/default.asp?id=877) en zie ook http://www.sovon.nl/pdf/Rietganzencomplex.pdf (http://www.sovon.nl/pdf/Rietganzencomplex.pdf)
 
Groetjes, Klaas

Wat is julie mening over dit stuk? is dit volgend jaar in het veld goed bruikbaar of zijn er toch kantekeningen te plaatsen?
Titel: Re: rietgans, again...
Bericht door: Martijn Bot op mei 06, 2010, 13:48:49 pm
Ze zijn groot (maar dat wisten we al)!
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=33492 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=33492)
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op mei 06, 2010, 16:06:27 pm
Ze zijn groot (maar dat wisten we al)!
http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=33492 (http://www.netfugl.dk/pictures.php?id=showpicture&picture_id=33492)

en wat maakt dit nu een taiga en geen grote toendra?
Titel: Re: rietgans, again...
Bericht door: andre op mei 06, 2010, 20:57:22 pm
Ik ben bang dat je het hele topic weer door moet spitten , van het begin tot het einde , om je zelf antwoord te geven op de door jouw gestelde vraag .
 
Andre
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op mei 06, 2010, 22:28:20 pm
Utterslev Mose is een prachtig mooi park in Kopenhagen met een heleboel broedparen van de Grauwe Gans. Flink wat van deze Grauwe Ganzen lusten graag brood en eten ook wel brood uit de hand. Het is ook een prima park om flink wat geringde Kok- en Stormmeeuwen af te lezen (na ze flink te hebben gevoerd). Soms staan de Grauwe Ganzen dan flink in de weg.
 
Determinatie van de linkergans zou toch een peulenschil moeten zijn met behulp van http://www.sovon.nl/default.asp?id=877 (http://www.sovon.nl/default.asp?id=877) en http://www.sovon.nl/pdf/Rietganzencomplex.pdf (http://www.sovon.nl/pdf/Rietganzencomplex.pdf) Rechts staat m.i. een Grauwe Gans.
 
Groetjes, Klaas
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 11, 2010, 15:54:47 pm
Beste rietganzenfreaks,
 
Het winterseizoen is aangebroken en dat betekent dat er weer grote aantallen Rietganzen naar Nederland komen. En dus weer hoofdpijn om Taigarietgans en Toendrarietgans van elkaar te onderscheiden. Op de komende Landelijke Dag van Sovon (Nijmegen, 27 november 2010; gratis toegankelijk voor iedereen!) staat een mooie lezing over de rietganzenproblematiek op het programma.
 
Via wat knip- en plakwerk van de site van Sovon:
 
14:30 - 15:00 (zaal 1): "Are Taiga Bean Geese disappearing from Western Europe?" door Thomas Heinicke (Dachverband Deutscher Avifaunisten, DDA)
 
"The Taiga Bean Goose was once a regular winter visitor in Western Europe, with largest numbers occurring during very cold weather periods in southern Scandinavia and/or Eastern Germany. But during the last 20 years, the appearance of wintering Taiga Bean Geese in Europe has been changed dramatically through changes in distribution and phenology, but also because of changes in their numbers. The talk will give an up-to-date overview about the latest knowledge on the winter distribution and current population size of Taiga Bean Geese in Europe and will also discuss, if and how many Taiga Bean Geese still reach Western Europe. As a correct field identification of Taiga and Tundra Bean Geese is essential for an exact knowledge on population size and development, pitfalls in field ID are demonstrated. Furthermore, the question will be raised, if Bean Geese in Scandinavia can automatically be assumed as Taiga Bean Geese."
 
Zie ook http://www.sovon.nl/default.asp?id=263 (http://www.sovon.nl/default.asp?id=263) en http://www.sovon.nl/default.asp?id=892 (http://www.sovon.nl/default.asp?id=892) voor nadere details over de Landelijke Dag.
 
Ik ga in ieder geval naar deze lezing toe!

Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 11, 2010, 16:52:00 pm
Ik ben eveneens erg benieuwd en hoop ook te gaan. Vooral naar de 'pitfalls in field ID' ben ik benieuwd. En of er zonder meer vanuit wordt gegaan dat taiga en toendra uit elkaar te houden zijn.

O, ja. Het programmapunt erna is natuurlijk ook interessant: Theo over de opmars van Cetti's zanger in de Biesbosch.
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 11, 2010, 22:59:47 pm
Gaat Heinicke nou een grens trekken tussen taiga en toendra?
Dat geloof ik niet. Tenzij hij al jaren lang vogels ringt en beschrijft uit beide zekere broedgebieden.
Voor de liefhebbers hieronder een resultaat van onderzoek door Peter de Knijff.
Het gaat over meeuwen maar ik denk dat Ben het wel kan plaatsen in de gansjessoep.

Theo


  Theo,
 
 
Hieronder een link die je wel leuk zult   vinden.
 
Het is een artikel welke vnadaag uit is   gekomen.
 
Over een week of wat komt het ook in een beter formaat   beschikbaar.
 
Het is een zgn public access tijdschrift dus toegang zal   voor iedereen gratis blijven (ik heb de rechten afgekocht).
 
 
De take-home boodschap is complex, maar ik zal proberen het   uit te leggen.
 
 
Tot nu toe zijn we in de veronderstelling dat het ontstaan   van soorten, ondersoorten, en/of duidelijke geografische vormen, een min-of-meer   simpel proces is van afplitsingen van een paar vogels in een nieuwe richting,   gevolgd door langdurige isolatie waardoor een aan de buitenkant unieke nieuwe   herkenbare vorm ontstaat. een grote simplificatie met veel uitzonderingen, maar   je snapt wat ik bedoel.
 
Irrelevant is de taxonomische status, soort of ondersoort   is niet belangrijk hier.
 
 
Wat we nu bij alle grote meeuwen zien (in dit verhaal   beschijven we in detail de grote burry, grote mantel en zilver, maar we hebben   inmiddels ook identieke data van alle relevante klm vormen) is dat er een zeer   slechte correlatie is tussen de genetische samenstelling van een individuele   meeuw en zijn broedkolonie.
 
Bij de Zilvermeeuw herkennen we vier zeer duidelijk   herkenbare genetische groepen.
 
Echter, de geografische verdeling van deze groepen is zeer   complex.
 
Het lijkt erop dat er wel een paar trends zichtbaar zijn,   maar dat niets perfect is.
 
Ik denk dat dit komt doordat er voortdurende uitwisseling   is van meeuwen tussen kolonies.
 
Het is welliswaar zo dat iedere kolonie wellciht een   bepaalde hoofd-samenselling zal hebben, maar er zijn altijd ook een voldoende   aantal genetische uitzonderingen aan te treffen.
 
Dit heeft als resultaat dat er nauwelijks een correlatie is   tussen de broedlokatie van een meeuw en zijn genetisch   ***SPAM***.
 
Wellicht is dit ook de verklaring voor de zeer grote   variatie in vooral de jonge kleden van meeuwen binnen iedere   kololnie.
 
Ook zal dit proces de reden zijn waarom het zo verdomd   moeilijk is om b.v. ondubbelzinnig aan te geven of lichte matels altijd   argenteus is, en donkere mantels argentatus, en dat licht allaan in het westen   voorkomt en donker in het oosten, of noorden en zuiden.
 
Het beeld wat wij hebben van de variatie in zilvermeeuw   kleden in zijn volledige verspreidingsgebied is beroerd   slecht.
 
Mede door de nu door ons waargenomen genetische   complexiteit, zorgt ervoor dat we weer met een andere bril moeten leren   kijken.
 
 
Veel leesplezier, en stuur de link gerust door. Het is voor   iedereen altijd gratis. Ik heb de rechten, niet het   tijdschrift.
 
   
gr. Peter
 
 
 
http://www.biomedcentral.com/1471-2148/10/348 (http://www.biomedcentral.com/1471-2148/10/348)
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 12, 2010, 16:41:01 pm

"er een zeer slechte correlatie is tussen de genetische samenstelling van een individuele meeuw en zijn broedkolonie."

Stel dat hetzelfde het geval is bij rietganzen. Dat de genetische samenstelling enorm varieert binnen bepaalde afgebakende broedkolonies (lees: broedgebieden, want in hoeverre kan je bij rietganzen van kolonies spreken).
Dat zou desastreus zijn voor de vooronderstelling dat de populaties uit elkaar te houden zijn. Min of meer lieten Ruokonen e.a. (2009) dat al wel een beetje zien, maar hun onderzoek is hier al ontrafeld als weinig valide.

De discussie die we hier inmiddels gehouden hebben draait in de kern nog steeds om de vraag naar een goed onderzoek. Onderzoek dat in de afgelopen honderd jaar nog nooit is uitgevoerd, maar goed te onderbouwen zou zijn. Op de manier zoals dat al jaren met andere ganzensoorten en vooral grote meeuwen is gedaan.

1. Wat is de genetische samenstelling van rietganzen in de broedgebieden?
2. Waarheen bewegen de -geringde- vogels zich vanuit de broedgebieden?
3. Zijn eventuele significante genetische verschillen ook biometrisch zichtbaar?
4. Kan de vogelaar iets me de uitkomst van 3?

Zolang een dergelijk onderzoek niet gedaan is, houden we ons bezig met cirkelredeneringen wat betreft de ID.

Kortom, wanneer gaat Bart Ebbinge nu eens met een team naar Lapland en Rusland om honderden rietganzen te samplen en te ringen? Of, wie wil er op promoveren?


Titel: Re: rietgans, again...
Bericht door: Fred Hustings op november 18, 2010, 15:07:36 pm
Workshop determinatie van rietganzen op de landelijke dag van SOVON

Op de landelijke dag van SOVON op 27 november a.s. geeft de Duitse rietgans-specialist Thomas Heinicke een presentatie over de actuele status en verspreiding van Taigarietganzen in Europa. Bij de presentatie staan vooral de veranderingen in trekstrategie en de populatietrends centraal. Vanwege de tijd kan minder aandacht worden besteed aan de bekende determinatieperikelen. Vandaar dat aansluitend op de presentatie een speciale workshop wordt georganiseerd waar gediscussieerd kan worden over de manier waarop Taigarietganzen gedetermineerd zouden moeten worden. Thomas Heinicke kent Taigarietganzen uit Duitsland, Zweden en Rusland en heeft veel ervaring met de soort. Iedereen die in dit onderwerp is geďnteresseerd, is welkom! Neem eventueel ook een selectie van foto's mee van al dan niet vermeende Taigarietganzen (USB stick, CD); in de zaal zijn een laptop en beamer aanwezig. De workshop zal plaatsvinden in zaal 5, vanaf 15:00 (aansluitend op de presentatie in zaal 1).
Op de website van SOVON is via de link http://www.sovon.nl/default.asp?id=877 een overzicht van determinatiekenmerken beschikbaar, incl. fotomateriaal.

Meer informatie over de workshop is verkrijgbaar bij Kees Koffijberg, kees.koffijberg@sovon.nl.
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 18, 2010, 16:19:57 pm
Dat is lekker geregeld, maar niet heus.
Om 3 uur is er een vervolg van de lezingen in zaal 1, waar toevallig ikzelf een lezing houd.
Nu wordt er dus gevraagd te kiezen naast het feit dat ik in ieder geval niet zelf kan deelnemen aan de rietganzen discussie.
Je wordt bedankt!

Theo Muusse
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 18, 2010, 18:12:00 pm
Dat is lekker geregeld, maar niet heus.
Om 3 uur is er een vervolg van de lezingen in zaal 1, waar toevallig ikzelf een lezing houd.
Nu wordt er dus gevraagd te kiezen naast het feit dat ik in ieder geval niet zelf kan deelnemen aan de rietganzen discussie.
Je wordt bedankt!

Theo Muusse

Jij bent toch om half vier volgens het programma (http://www.sovon.nl/default.asp?id=892)? Ik denk dat de workshop tussen drie en half vier is. Ik laat de thee er graag koud voor worden.

Titel: Re: rietgans, again...
Bericht door: hterhaar op november 21, 2010, 17:46:31 pm
Rietgans in Californië (http://birdingfrontiers.com/), en zeker even doorklikken naar de eerste Rietganzen in Hong Kong (http://www.hkbws.org.hk/BBS/redirect.php?tid=12478&goto=lastpost#lastpost) - lijkt me inderdaad een double whammy !

Gr.,

Hans
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 26, 2010, 16:53:58 pm
Rietgans in Californië (http://birdingfrontiers.com/), en zeker even doorklikken naar de eerste Rietganzen in Hong Kong (http://www.hkbws.org.hk/BBS/redirect.php?tid=12478&goto=lastpost#lastpost) - lijkt me inderdaad een double whammy ! Gr., Hans

Hans, bedankt hiervoor. Erg mooie & duidelijke foto's & een leuke discussie! Geen tamme / ontsnapte vogels? Jammer dat het maar niet lukt om foto's van zo'n korte afstand te maken van wilde Taigarietganzen in Nederland.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: gjcaspers op november 27, 2010, 19:06:24 pm
Ik moet toch zeggen dat ik na de lezing en workshop van Heinicke nog steeds met rietgansvragen blijf zitten.
 
Wat de determinatie betreft: ik ben bang dat ik nog heel wat rietganzen ga tegenkomen die volgens Heinicke duidelijk taigavrouw of toendraman zijn, maar voor mij min of meer intermediair...
 
Wat de verspreiding betreft: zoals Heinicke de gegevens presenteert, lijkt het dat de Europese Taigarietganzen dichter bij hun broedgebieden zijn gaan overwinteren. Maar in hoeverre dit werkelijk zo is, en of we niet voornamelijk naar het verdwijnen van West-Siberische Taiga's als wintergast in Europa kijken, daar kreeg ik toch niet echt een antwoord op. En trokken die West-Siberische Taiga's voorheen dan over de overwinterende Europese Taiga's heen? En waar zijn ze nu? Uitgestorven, of hebben ze hun winterkwartieren naar het zuidoosten verlegd? Er zijn immers in Nederland geringde Taiga's teruggemeld uit Centraal-Azië. Vragen, vragen, maar nog steeds geen definitieve antwoorden...
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 27, 2010, 21:01:22 pm
Ik moet toch zeggen dat ik na de lezing en workshop van Heinicke nog steeds met rietgansvragen blijf zitten.
 
Wat de determinatie betreft: ik ben bang dat ik nog heel wat rietganzen ga tegenkomen die volgens Heinicke duidelijk taigavrouw of toendraman zijn, maar voor mij min of meer intermediair...

Dat hangt er helemaal vanaf wat je als referentie gaat gebruiken. Gelukkig ziet Heinicke per jaar meer taiga's dan wij hier ooit nog gaan zien, over referentie gesproken. Na vanmiddag beseffen we natuurlijk dat wij in de luxepositie zitten dat er doorgaans maar één ondersoort van de grote rietgans in ons land overwintert, over referentiekader gesproken.


Citaat

Wat de verspreiding betreft: zoals Heinicke de gegevens presenteert,   lijkt het dat de Europese Taigarietganzen dichter bij hun broedgebieden   zijn gaan overwinteren. Maar in hoeverre dit werkelijk zo is, en of we   niet voornamelijk naar het verdwijnen van West-Siberische Taiga's als   wintergast in Europa kijken, daar kreeg ik toch niet echt een antwoord   op. En trokken die West-Siberische Taiga's voorheen dan over de   overwinterende Europese Taiga's heen? En waar zijn ze nu? Uitgestorven,   of hebben ze hun winterkwartieren naar het zuidoosten verlegd? Er zijn   immers in Nederland geringde Taiga's teruggemeld uit Centraal-Azië.   Vragen, vragen, maar nog steeds geen definitieve antwoorden...
 
Als uitgebreid antwoord op de vraag van vanmiddag over johanseni vond ik deze (http://www.wwt.org.uk/files/Wildfowl_59/10_Heinicke_2_pp77_99.pdf) nog. Je kunt je bovenstaande vraag natuurlijk prima naar Thomas mailen. Hij zal vast een antwoord hebben.
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 27, 2010, 21:37:12 pm
Wat ik eraan over heb ghouden is een erg duidelijk verhaal...
De nog maar 60000 vogels tellende westerse populatie komt met hevige kou uit Zweden gezakt maar niet meer verder dan de NO punt van Denemarken, de NO punt van Duitsland en NW Polen.
Ofwel, zelfs west Duitsland is de laatste jaren gewoon leeg.
Thomas is ook in NL geweest en heeft gezocht op alle plekken waar Taiga's waren gemeld; eindstand rossicus 17000 - fabalis 0!

Taiga is bovendien sterk aan het afnemen door de toename van rossicus als side-effect.

Taiga zit apart, niet tussen rossicus.

Het geluid is duidelijk anders, veel meer Grauwe Gans.

Conclusie: Taiga zit niet meer in NL, zeker niet in groepen. De enige kans is in januari in strenge winters helemaal in het noorden van ons land. De grote uitzondering zal er vast wel zijn. Heel veel foto's van wrn.nl werden resoluut weggewoven.
Er is niet veel meer over van de populatie in ons land.

Conclusie 2; iedereen onder de 30 mag zijn Taiga's verantwoorden! Want sinds de strenge winter van 1986 is de soort gewoon erg zeldzaam geworden. Hij mag dus naar de CDNA/ in donkerrood!!

Theo
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op november 27, 2010, 21:48:50 pm
Wat ik eraan over heb ghouden is een erg duidelijk verhaal...
De nog maar 60000 vogels tellende westerse populatie komt met hevige kou uit Zweden gezakt maar niet meer verder dan de NO punt van Denemarken, de NO punt van Duitsland en NW Polen.
Ofwel, zelfs west Duitsland is de laatste jaren gewoon leeg.
Thomas is ook in NL geweest en heeft gezocht op alle plekken waar Taiga's waren gemeld; eindstand rossicus 17000 - fabalis 0!

Taiga is bovendien sterk aan het afnemen door de toename van rossicus als side-effect.

Taiga zit apart, niet tussen rossicus.

Het geluid is duidelijk anders, veel meer Grauwe Gans.

Conclusie: Taiga zit niet meer in NL, zeker niet in groepen. De enige kans is in januari in strenge winters helemaal in het noorden van ons land. De grote uitzondering zal er vast wel zijn. Heel veel foto's van wrn.nl werden resoluut weggewoven.
Er is niet veel meer over van de populatie in ons land.

Conclusie 2; iedereen onder de 30 mag zijn Taiga's verantwoorden! Want sinds de strenge winter van 1986 is de soort gewoon erg zeldzaam geworden. Hij mag dus naar de CDNA/ in donkerrood!!

Theo

Begrijpelijk verhaal!
Maar zijn er nu uit duidelijk blijkbare veldkenmerken naar boven gekomen? Immers lukt het thomas als ik bovenstaande interpreteer dus wel om 100% van de rietganzen op naam te brengen.
Titel: Re: rietgans, again...
Bericht door: HPM op november 27, 2010, 21:52:04 pm
[...]
Conclusie 2; iedereen onder de 30 mag zijn Taiga's verantwoorden! Want sinds de strenge winter van 1986 is de soort gewoon erg zeldzaam geworden. Hij mag dus naar de CDNA/ in donkerrood!!

Theo

Dat wordt een aardige klus
http://waarneming.nl/soort/stats/338 (http://waarneming.nl/soort/stats/338)
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 27, 2010, 21:54:40 pm
Ja! Thomas heeft geen twijfelvogels want bij hem zitten alle toendra's aan de ene kant van de weg in het veld en de taiga's in een veld aan de andere kant.
Ook gaf hij aan dat het totale pakket altijd de doorslag geeft, nooit 1 kenmerk.
Dus geluid, snavelkleur, snavelvorm, neklengte, nekdikte, lichaam en groepsverband.
Fabalis zit daar hoogstens aan de rand van de groep, nooit ertussen. Ze blijven ook de hele winter zo goed als op de zelfde plek.

Theo
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 27, 2010, 21:56:51 pm
Erg opvallend in zijn verhaal is ook de erg late aankomst in het zuiden. De piek wordt pas in januari gehaald en pas in december, hooguit onregelmatig eind november komen de eersten.

Theo
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op november 27, 2010, 22:35:54 pm
Duidelijk!

Worden er nu nog stappen ondernomen richting CDNA/waarneming.nl?
Titel: Re: rietgans, again...
Bericht door: ArjenDrost op november 27, 2010, 22:46:21 pm
Worden er nu nog stappen ondernomen richting CDNA/waarneming.nl?
Welke stappen zouden dan ondernomen moeten worden en wie zou die dan moeten nemen?
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op november 27, 2010, 22:58:55 pm
CDNA zou stappen kunnen ondernemen taiga tot beoordeelsoort te bombarderen (met terugwerkende kracht? tot?)
Wrn.nl zou mocht dat gebeuren automatisch in de voetstappen van de CDNA volgen
Een hoop waarnemers zouden zelf nog eens stapsgewijs door hun (oude) taigawaarnemingen kunnen lopen.

Al met al een hele wandeling!
Titel: Re: rietgans, again...
Bericht door: frankneijts op november 27, 2010, 23:02:16 pm
Ik denk dat Folkert-Jan bedoelt (of anders zou moeten bedoelen..): ondernemen de CDNA en/of Waarneming.nl nog stappen als het gaat om het al of niet aanvaarden/accepteren van Taigarietgans-waarnemingen? Immers zijn dit autonome instellingen die zelf bepalen wat er wel of niet beoordeeld wordt.
CDNA: Aangezien fabalis geen indiensoort is zal daar eerst een besluit over moeten worden genomen.
Waarneming.nl: We hadden de beslissing m.b.t. de beoordeling van beide 'grote' rietgans-taxa al opgeschort en zouden nu dus vrij eenvoudig kunnen beslissen om (bijvoorbeeld!!) waarnemingen van Taigarietgans pas te accepteren ná fotografisch en/of auditief bewijsmateriaal + uitgebreide beschrijving van de omstandigheden (groepssamenstelling, positie t.o.v. andere ganzen etc.). Tenzij natuurlijk de CDNA zou besluiten er een indiensoort van te maken......
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op november 27, 2010, 23:04:17 pm
CDNA zou stappen kunnen ondernemen taiga tot beoordeelsoort te bombarderen (met terugwerkende kracht? tot?)
Wrn.nl zou mocht dat gebeuren automatisch in de voetstappen van de CDNA volgen
Een hoop waarnemers zouden zelf nog eens stapsgewijs door hun (oude) taigawaarnemingen kunnen lopen.

Al met al een hele wandeling!

En hoe zit het tot die tijd met de beoordeling van waarnemingen door waarneming.nl? Komen de toekomstige waarnemingen ook op (nog) niet onderzocht te staan of worden ze vanaf nu wel beoordeeld?
Titel: Re: rietgans, again...
Bericht door: frankneijts op november 27, 2010, 23:10:53 pm
CDNA zou stappen kunnen ondernemen taiga tot beoordeelsoort te bombarderen (met terugwerkende kracht? tot?)
Wrn.nl zou mocht dat gebeuren automatisch in de voetstappen van de CDNA volgen
Een hoop waarnemers zouden zelf nog eens stapsgewijs door hun (oude) taigawaarnemingen kunnen lopen.

Al met al een hele wandeling!

En hoe zit het tot die tijd met de beoordeling van waarnemingen door waarneming.nl? Komen de toekomstige waarnemingen ook op (nog) niet onderzocht te staan of worden ze vanaf nu wel beoordeeld?

Als ik het allemaal goed begrijp hebben wij (admins) het een stuk makkelijker gekregen: 99,9% zal gewoon Toendra zijn, daar hoeven we bij wijze van spreken niet eens meer naar te kijken...... 8)
 
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 28, 2010, 00:06:25 am
En zo makkelijk lijkt het nu ook te zijn, Frank.
Na het duidelijke verhaal van vandaag en dito plaatjes heb ik al de vrijheid genomen de 41 blz met foto's van Taiga te bekijken en op 1 a 2 foto's na zie ik alleen maar echte toendra's.
Op blz 28 en op blz 35 staan 2 lastige (door de foto) maar de rest durf ik zo te scharen onder toendra.
Allemaal.
Ook mijn post-2000 waarnemingen zal ik zsm van de juiste naam voorzien.

Theo
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 28, 2010, 00:49:32 am
Een goede lezing, en bedankt Theo dat je je Cetti's verhaal voor een tweede keer kwijt wilde; bezien de inhoud was dat geen treurigheid lijkt me.
Het verhaal van Thomas bevestigt wel de bevindingen van onze telgroep in de Engbertsdijksvenen, waar we in de winter van '86-'87 nog 1500 Taiga's hadden maar een orde van grootte  die begin jaren '90 reeds een onmogelijkheid was geworden.
Echte Taiga's zijn al sinds vele jaren hangen en wurgen. Vogels die je op de akkers ziet betreffen eigenlijk altijd Toendra's
Ook het patroon van aankomst van de Taiga's van weleer staat me nog helder voor de geest en is in volle overeenstemming met Thomas' weergave van de Duitse situatie. Hooguit enkele honderden vroeg in de winter, met een piek in januari.
Enkele weken geleden hadden we 'al' 6500 Toendra's hier op de slaapplaats; iets wat zelfs in strenge winters bij Taiga's nooit optrad met 'vele honderden'.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 28, 2010, 12:36:23 pm
Als ik het allemaal goed begrijp hebben wij (admins) het een stuk makkelijker gekregen: 99,9% zal gewoon Toendra zijn, daar hoeven we bij wijze van spreken niet eens meer naar te kijken.

 
Ja. Alle ingevoerde Zilvermeeuwen kijken jullie ook niet na, terwijl daar best af en toe een Pontische Meeuw tussen zit.
 
De kans op een onterecht ingevoerde Taigarietgans is vele malen kleiner. Hoeveel Pontische Meeuwen zitten er tiijdens de midwinterperiode in Nederland? Hoeveel Pontische Meeuwen zitten er tijdens de zomer / nazomer in Nederland? Zet dat maar eens af tegen de aantallen Taigarietganzen die volgens Thomas Heinicke en ook volgens ganzendeskundigen als bijvoorbeeld Trinus Haitjema jaarlijks in Nederland worden gezien (vogels waarvan dus goed bewijsmateriaal van voorhanden is).
 
De situatie in Nederland is inderdaad duidelijk.
 
(1): alle Rietganzen in Nederland zijn Toendrarietganzen. Dat is de default.
 
(2): het hangt van het boek (en het land waarin je woont) en van jouw visie over soortsconcepten etc. af of je deze vogels benoemt met de wetenschappelijke soortsnaam Anser fabalis of de wetenschappelijk soortsnaam Anser serrirostris.
 
(3): alle (hoge) aantallen vanaf pakweg 2000 (of vanaf 1995?) van Taigarietganzen in Nederland die in de Sovonrapporten etc. staan zijn (voorlopig) af te boeken als 'onwaarschijnlijk' cq 'niet / onvoldoende gedocumenteerd'.
 
Theo, ook een erg leuke lezing over de Cetti's Zangers in de Biesbosch! Gelukkig waren beide lezingen en de uitleg over de determinatie goed met elkaar te combineren.
 
Ook erg leuk dat een workshop over de determinatie van Rietganzen een bomvolle zaal mensen trok! De materie leeft duidelijk.
 
Dus een midwintertripje maken naar Rügen e.o. en een een paar dagen daar goed de Rietganzen bestuderen (en fotograferen). Dan kom je vast beter beslagen ten ijs bij het herkennen & opsporen van Taigarietganzen in Nederland. En wellicht levert een stel geweldige nieuwe foto's uit deze gebieden ook nog wel een leuke publicatie in DB op!
 
Ook in Limburg is men nu behoorlijk streng m.b.t. het aanvaarden van waarnemingen van Taigarietganzen, zie bv de update van de 'Avifauna van Limburg' op http://vogels.nhgl.nl/images/magazine/UPDATE%202010%20Avifauna%20van%20Limburg.pdf (http://vogels.nhgl.nl/images/magazine/UPDATE%202010%20Avifauna%20van%20Limburg.pdf)
 
Vriendelijke groeten,
 
Klaas van Dijk
 
 
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 28, 2010, 13:56:10 pm
Pontische meeuwen zijn in het begin inderdaad ook niet gedetecteerd.
Nu is dat wel zo, na enkele jaren snuffelen in de materie.

Het verschil is alleen dat Ponten wel in NL voorkomen.

Overeenkomst is dat je met oegening zowel een Pont kan herkennen als een Taiga.

THeo
Titel: Re: rietgans, again...
Bericht door: Ben Gaxiola op november 28, 2010, 14:20:19 pm
En zo makkelijk lijkt het nu ook te zijn, Frank.
Na het duidelijke verhaal van vandaag en dito plaatjes heb ik al de vrijheid genomen de 41 blz met foto's van Taiga te bekijken en op 1 a 2 foto's na zie ik alleen maar echte toendra's.
Op blz 28 en op blz 35 staan 2 lastige (door de foto) maar de rest durf ik zo te scharen onder toendra.
Allemaal.
Ook mijn post-2000 waarnemingen zal ik zsm van de juiste naam voorzien.

Theo

Hoho Theo, rustig nou...  ;)
 
Aan het eind van de workshop bevestigde Thomas desgevraagd dat op waarneming.nl wel degelijk foto's staan van Taigarieten waargenomen in de afgelopen "behoorlijk" strenge winter. Hij was niet specifieker helaas, maar ik kan me zo voorstellen dat iig op de foto's van Theo Bakker Taigarieten staan.
 
Groet, Ben
 
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 28, 2010, 16:13:46 pm
Pontische meeuwen zijn in het begin inderdaad ook niet gedetecteerd. Nu is dat wel zo, na enkele jaren snuffelen in de materie. Het verschil is alleen dat Ponten wel in NL voorkomen. Overeenkomst is dat je met oefening zowel een Pont kan herkennen als een Taiga. Theo

Yep, volkomen mee eens. Maar het onderscheid Zilvermeeuw / Pontische Meeuw zal lang niet altijd goed lukken bij grootschalige tellingen, bijvoorbeeld op slaapplaatsen / tijdens slaaptrek en bij hoogwatertellingen. Dan moet je vaak in een snel tempo zeer grote aantallen tellen & kun je gewoon niet al teveel op details letten cq de grote groepen zitten erg ver weg en/of het is al half donker etc. En er zijn genoeg tellers die niet / nauwelijks letten op Pontische Meeuwen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Timo Roeke op november 28, 2010, 19:59:50 pm
Mijn taiga eraf gehaald.. vertrouw het niet meer :)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 28, 2010, 21:07:47 pm
En trokken die West-Siberische Taiga's voorheen dan over de overwinterende Europese Taiga's heen? En waar zijn ze nu? Uitgestorven, of hebben ze hun winterkwartieren naar het zuidoosten verlegd? Er zijn immers in Nederland geringde Taiga's teruggemeld uit Centraal-Azië.   Vragen, vragen, maar nog steeds geen definitieve antwoorden. Als uitgebreid antwoord op de vraag van vanmiddag over johanseni vond ik deze (http://www.wwt.org.uk/files/Wildfowl_59/10_Heinicke_2_pp77_99.pdf) nog. Je kunt je bovenstaande vraag natuurlijk prima naar Thomas mailen. Hij zal vast een antwoord hebben.

hoi Albert,
 
In de eerste plaats zeer bedankt voor het vinden van deze link. Ik had afgelopen winter al eens gezocht naar een digitale versie van dit artikel, maar kon het toen niet op internet vinden. Anderhalve week geleden was ik in de bibliotheek van de RUG (daar staan veel nummers van Wildfowl) en toen had ik er dus maar een fotokopie van gemaakt. Nu meteen gedownload.
 
Tuurlijk, er zijn nog erg veel vragen over. En die vragen zullen niet worden opgelost zolang we niets weten over wat er allemaal in Rusland gebeurt cq waar de exacte grenzen liggen van de verschillende broedpopulaties. Verder kunnen populaties heel goed 'over elkaar heen' trekken cq gescheiden wintergebieden hebben. Daarvan zijn legio voorbeelden bekend. Na afloop heb ik ook nog even een tijdlang met Thomas staan praten. M.i. is het prima als je hem per e-mail ook nog vragen stelt.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Ted van der Knaap op november 28, 2010, 21:17:05 pm
Ik wilde eigenlijk een nieuw topic openen bij determinatie maar zie deze nu bovenaan bij 't Forum staan.
 
Vanmiddag tussen Driel en Heteren in de uiterwaarden Kol- en Grauwe ganzen en deze pik ik er op de foto's uit. Stonden naast elkaar.
Links Toendra en rechts Taiga?
 
(als ie hier niet op z'n plek staat moet 'n Admin 'm maar even verplaatsen!)
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op november 28, 2010, 21:20:29 pm
Ik wilde eigenlijk een nieuw topic openen bij determinatie maar zie deze nu bovenaan bij 't Forum staan.
 
Vanmiddag tussen Driel en Heteren in de uiterwaarden Kol- en Grauwe ganzen en deze pik ik er op de foto's uit. Stonden naast elkaar.
Links Toendra en rechts Taiga?
 
(als ie hier niet op z'n plek staat moet 'n Admin 'm maar even verplaatsen!)
Ted, heb je de pagina's en met name de afgelopen twee pagina's goed doorgelezen. M.u.v. een paar vogels afgelopen winter in Groningen en Zeeuws-Vlaanderen en her en der een enkele vogels in de jaren tussen de winter 1985/1986 en nu, zijn er geen goed gedocumenteerde waarnemingen van Taigarietgans. Ook jouw vogels behoren daar niet toe.
Titel: Re: rietgans, again...
Bericht door: Ted van der Knaap op november 28, 2010, 21:22:51 pm
Ik wilde eigenlijk een nieuw topic openen bij determinatie maar zie deze nu bovenaan bij 't Forum staan.
 
Vanmiddag tussen Driel en Heteren in de uiterwaarden Kol- en Grauwe ganzen en deze pik ik er op de foto's uit. Stonden naast elkaar.
Links Toendra en rechts Taiga?
 
(als ie hier niet op z'n plek staat moet 'n Admin 'm maar even verplaatsen!)
Ted, heb je de pagina's en met name de afgelopen twee pagina's goed doorgelezen. M.u.v. een paar vogels afgelopen winter in Groningen en Zeeuws-Vlaanderen en her en der een enkele vogels in de jaren tussen de winter 1985/1986 en nu, zijn er geen goed gedocumenteerde waarnemingen van Taigarietgans. Ook jouw vogels behoren daar niet toe.

Ik heb helemaal niets gelezen en postte deze er even tussendoor... ...ga het straks even doornemen!
Titel: Re: rietgans, again...
Bericht door: Ted van der Knaap op november 28, 2010, 21:55:58 pm
Als ik snel even lees zijn mijn ganzen dus beiden Toendra's... ...gelet op de verschillen bij bovenstaande ganzen valt dat dus allemaal onder "variatie binnen de (Toendra) soort"!
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 28, 2010, 21:57:03 pm
Ja, Ben, we gaan los nu!
De vogels van Theo Bakker staan er ook tussen, inderdaad, 18 feb 2010, groepje.
Dat ziet er dus nog goed uit, geluid bekend weet ik niet.

De vogels van Retranchement, Z-Vl van Peter Meininger (maart 2010) vind ik duidelijk minder sterk. Mocht Thomas die okee vinden dan kijk ik te streng.
Maar dat betwijfel ik.

En dus op blz 28 2 enge vogels die erg groot en slank overkomen (van Lutzen).

En dan nog ergens 1 die ik vandaag er al niet meer uithaal. Ver terug, blz 33+.

THeo

Een groepje zekere, inderdaad helemaal bovenin in een relatief koudere winter.
Wat een enorme afname dus....
Titel: Re: rietgans, again...
Bericht door: Bas vd Burg op november 28, 2010, 22:19:46 pm
Hoi theo, dan ben ik ook erg benieuwd wat je nu van de vogel van Polder Boekhorst (ZH) vindt. In januari/februari 2008 zat hier een rietgans die is doorgegeven als Taiga en door veel mensen is getwitcht. http://waarneming.nl/gebied/view/21287?g=0&from=2008-01-01&to=2008-02-19&sp=338&z=1&u=0&page=2 (http://waarneming.nl/gebied/view/21287?g=0&from=2008-01-01&to=2008-02-19&sp=338&z=1&u=0&page=2)
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 28, 2010, 22:30:30 pm
De foto's zijn niet groots maar op enkele lijkt het wel aardig goed eruit te zien.
OP andere zie ik weer erg veel toendra.
Lastig zo.
Ik weet nog dat ik hem toen niet heb kunnen vinden.

Theo
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 28, 2010, 22:44:28 pm
Een ander leuk drama: jaarlijst en big day records, waar zijn in die records de taiga's gezien?

In 1992 hadden we er maar 1 (rietgans) maar ik weet nog wel dat ik er toen naar gezocht heb in Groningen (zal het eens opzoeken).

Theo
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op november 28, 2010, 22:50:10 pm
Werd uit de lezing een beetje duidelijk hoe variabel Toendra en vooral ook Taiga is? En hoe zit het met contactzones (scherp of geleidelijk)? Niemand die het toevallig heeft opgenomen en op youtube gezet?
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op november 29, 2010, 07:02:00 am
maar ik kan me zo voorstellen dat iig op de foto's van Theo Bakker Taigarieten staan.

Niet op alle Taigafoto's van Theo Bakker staan Taiga's: http://waarneming.nl/foto/view/1053540 (http://waarneming.nl/foto/view/1053540)
 
Theo M. bedankt voor het verslag van zaterdag. Eindelijk gerechtigheid voor de preciezen in de rietganzendiscussie (en voor de verstandige figuren die afgelopen winter naar Woldendorp zijn gereden...). Wel ben ook ik erg benieuwd of en zo ja hoe Heinicke e.e.a. heeft onderbouwd. En heeft de man ook nog iets gezegd over zwartbekken van dit kaliber http://waarneming.nl/waarneming/view/46280768 (http://waarneming.nl/waarneming/view/46280768), want die vind ik nog altijd erg spannend...
Titel: Re: rietgans, again...
Bericht door: Theo Bakker op november 29, 2010, 10:06:11 am
PieterGeert heeft gelijk  hoor, op die foto's staan inderdaad geen taiga's. Ik heb die foto's wel gemaakt maar ik heb ze niet op waarneming.nl gezet (ik wist ook niet dat ze er op stonden trouwens) en ik heb de vogels ook niet als zodanig gedetermineerd. Martin zal ze er wel af halen neem ik aan.
Helaas heb ik de lezing afgelopen zaterdag niet kunnen bijwonen.
 
Theo B
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 10:20:10 am
Helaas kon ik er vanwege Sinterklaas verplichtingen niet bij zijn zaterdag. Zeker de Rietganzen goeroe was voor mij eigenlijk een must geweest. Ik hoop dat er ooit nog eens iets in de gangbare bladen over wordt geschreven door hem. Teruglezende in dit topic heb ik wel een paar opmerkingen en vragen.
 
* Wanneer zijn Taiga's nu schaars geworden volgens hem?
* Ik verbaas me een beetje over Theo M zijn bevindingen dat er in 41 pagina's foto's van Taiga's slechts 2 echte Taiga's zitten. Ik weet zeker (zonder er zaterdag zijn geweest) dat het er meer zijn. Zie ondermeer de discussie van vorige winter waarbij er toch meer vogels werden gefotografeerd die door iedereen als zekere Taiga werden bestempeld (met name in Drenthe), maar ook Zuid Holland (nabij Katwijk) en Retrachement nu volgens Theo op eens niet meer overtuigend? ??? ). Die laatste twee plekken zouden goed te matchen zijn met de vogels die in de UK overwinteren en door sneeuw onze kant uit komen?
* Iedereen weet hoe zeldzaam Dwergganzen zijn (en dan bedoel ik niet de project populaties). Dwerggans komt jaarlijks met 10+ ex. in NL voor welke waarschijnlijk niet betrekking hebben op projectvogels (zitten in gebieden waar geen projectvogels zitten en zijn altijd ongeringd). Dwerggans is geen CDNA indiensoort. Ik kan me niet voorstellen op basis van de laatste populatieschattingen van Taiga Rietgans dat deze zeldzamer is dan Dwerggans. Het "opwaarderen" van Taiga Rietgans tot een CDNA indiensoort lijkt mij dus voorlopig niet logisch. Weet dat de officiële definitie van een indiensoort voor het CDNA is dat deze minder dan twee maal per jaar in NL wordt gezien.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 11:03:42 am
Beste mensen,
 
Net onderstaand verzoek ingediend bij de CDNA. Vriendelijke groeten, Klaas van Dijk
 
-------------------------------------------------------------------------------------
----- Original Message -----
From: Klaas van Dijk
To: cdna@dutchbirding.nl
Sent: Monday, November 29, 2010 10:58 AM
Subject: Taigarietgans beoordeelsoort maken

Beste mensen van de CDNA,
 
Hierbij dien ik een verzoek in om met terugwerkende kracht tot aan de eeuwwisseling (maar wellicht met terugwerkende kracht tot pakweg 1995) alle waarnemingen van Taigarietganzen in Nederland te gaan beoordelen. Er zijn diverse argumenten waarom Taigarietgans momenteel thuishoort op de lijst van door de CDNA te beoordelen soorten.
 

(1): Afgelopen zaterdag (27 november 2010) gaf Thomas Heinicke op de Landelijke Dag van Sovon c.s. in Nijmegen een lezing over Taigarietganzen. In deze lezing werd ingegaan op het huidige voorkomen van Taigarietganzen in Nederland. Thomas Heinicke concludeerde dat momenteel nauwelijks tot geen Taigarietganzen in Nederland overwinteren en dat deze situatie zeker al tien jaar zo is. Ik ken veel vogelaars en onderzoekers in Nederland die deze conclusie delen. Een dusdanig zeldzaam voorkomen van een soort in Nederland verdient een zorgvuldige documentatie en afweging. Het beoordelen van de waarnemingen door de CDNA is hiervoor het geijkte instrument.
 
 
(2): Er worden flinke aantallen Taigarietganzen vermeld in de jaarlijkse watervogelrapporten van Sovon. Tot nu toe zijn deze aantallen niet herroepen. De meeste rapporten staan online op de site van Sovon, zie ook http://www.sovon.nl/soorten.asp?euring=1571&lang=nl (http://www.sovon.nl/soorten.asp?euring=1571&lang=nl) . Een spoedig besluit van de CDNA om Taigarietgans met terugwerkende kracht te klassificeren als beoordeelsoort maakt dat ook al deze waarnemingen alsnog beoordeeld zullen moeten worden door de CDNA.

 
(3): In Limburg (zie het boek 'Avifauna van Limburg' uit 2006 en zie ook de update
http://vogels.nhgl.nl/images/magazine/UPDATE%202010%20Avifauna%20van%20Limburg.pdf (http://vogels.nhgl.nl/images/magazine/UPDATE%202010%20Avifauna%20van%20Limburg.pdf) heeft men deze stap al enkele jaren geleden gezet. Een beoordeling door de CDNA past bij deze lijn.

 
(4): In België (zie bijvoorbeeld http://www.bahc.be/Reports/BAHC%20Rapport%2033%202005%20Oriolus%20vol%2073%202007%20p%2052-61.pdf (http://www.bahc.be/Reports/BAHC%20Rapport%2033%202005%20Oriolus%20vol%2073%202007%20p%2052-61.pdf) heeft men voor een vergelijkbare aanpak gekozen. Wellicht zijn Taigarietganzen (door de Belgen als ondersoort beschouwd?) in België nog veel zeldzamer?
 

Het beoordelen door de CDNA van deze waarnemingen van Taigarietganzen zal dus (1) helderheid geven over de situatie in Nederland in de afgelopen 10-15 jaar, en (2) het kader aangeven hoe we om moeten gaan met toekomstige waarnemingen van Taigarietganzen in Nederland. Het kan best zijn dat na verloop van tijd zal blijken dat beoordeling door de CDNA niet meer nodig is, onder andere omdat het aantal waarnemingen te hoog is (vergelijkbaar met bijvoorbeeld Bladkoning). Maar dat lijkt me iets voor later zorg.
 
Ik hoop op een spoedige beslissing. In afwachting op een een inhoudelijke reactie,
 
Vriendelijke groeten,
 
Klaas van Dijk / Groningen
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 29, 2010, 11:22:54 am
[size=78%]De vogels van het Retranchement betreffen duidelijk Taiga's m.i. De vogels van de Oosterhesseler Landen[/size] zijn mijns inziens Toendra's waarbij twee vogels vrij veel oranje in de snavel tonen; dit komt volgens Thomas erg weinig voor (volgens wie niet) maar het komt dus voor. De halzen van deze zijn kort, de snavels aan de onderste snavelhelft uitgezakt en niet erg lang, en de lijven lijken niet groter dan omringende Toendra's
Volgens Heinicke zijn ze reeds begin jaren negentig in aantallen achteruit gegaan. Volgens onze telgroep ook.


T.H melde ook twee gevallen van gepaarde Taiga met Toendra. Daar zou je uit af kunnen leiden dat de twee juist erg weinig met elkaar op hebben. Op Varranger zijn beide soorten naast elkaar vertegenwoordigd  Ik zag daar enkel een creche van twee Taiga gezinnetjes in een biotoop van kale toendra, afgewisseld met laag berkebos wat een snel stromend riviertje met poelen omringde.


Johanseni lijkt niet te bestaan als geldige ondersoort en Middendorf's wordt geheel herzien meen ik als mogelijke eigen soort.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 11:29:04 am
Go Klaas, laat ik die postbus nou beheren, heb je mail helemaal niet gehad.... :angel:
 
Zonder gekheid. Ik zal hem officieel laten beantwoorden maar zie mijn opmerking over twee maal per jaar.
 
Het is volgens mij ook niet de oplossing immers je verschuift het probleem van SOVON naar het CDNA maar die weten allebei hetzelfde op dit moment.
 
Tevens geeft Heincke aan dat het een ontwikkeling is in de laatste jaren (vroeger waren ze algemener en dat is te bewijzen door oude foto's). De vraag is vanaf wanneer die aantallen zijn gaan dalen. Ik blijf geloven in mijn eigen waarnemingen in de tachtiger en negentiger jaren (en 2002).
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op november 29, 2010, 11:53:46 am
Volgens mij is de eerste stap nog steeds het eens worden over de te hanteren determinatiecriteria voor de diverse rietganzen-taxa. Wanneer we redelijk streng zijn in de leer, zou het mij niet verbazen wanneer het aantal 'aanvaardbare' taiga's in NL aardig in de buurt komt van gemiddeld 2 per jaar.
Titel: Re: rietgans, again...
Bericht door: JohanvantBosch op november 29, 2010, 12:11:59 pm
Ik vind beoordeling door CDNA een mooie manier om helder te krijgen hoeveel aanvaardbare waarnemingen er nu daadwerkelijk zijn.  Mocht blijken dat het er meer zijn dan 2 of 3 gevallen per jaar, dan kun je vervolgens besluiten om de soort niet meer te beoordelen. Zo is het uiteindelijk bij Pontische meeuw toch ook gegaan? Al konden we het daar van te voren niet weten...
 
Al weet ik natuurlijk niet of CDNA zich daarvoor wil laten gebruiken.
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op november 29, 2010, 12:18:42 pm
Ik vind beoordeling door CDNA een mooie manier om helder te krijgen hoeveel aanvaardbare waarnemingen er nu daadwerkelijk zijn.  Mocht blijken dat het er meer zijn dan 2 of 3 gevallen per jaar, dan kun je vervolgens besluiten om de soort niet meer te beoordelen. Zo is het uiteindelijk bij Pontische meeuw toch ook gegaan? Al konden we het daar van te voren niet weten...
 
Al weet ik natuurlijk niet of CDNA zich daarvoor wil laten gebruiken.

Volledig mee eens
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 12:22:27 pm
Max, ik heb gewoon het e-mail adres gebruikt wat op de site van DB staat. Laat me maar even weten als er op wat voor manier dan ook onderweg iets is misgegaan, want dan stuur ik de e-mail gewoon nogmaals op.
 
Zie deze e-mail gewoon als eerste stap. We moeten het uiteindelijk toch een keer eens worden. In Limburg (jouw thuisprovincie) is deze stap wel al gezet, dus waarom niet in de rest van het land? We zouden het in Groningen uitstekend vinden als het oordeel van de CDNA gevolgd kan worden.
 
En zolang niemand het eens schijnt en/of lijkt te zijn of er nu wel of niet gemiddeld 2 gevallen (of zo) van Taigarietganzen in Nederland zijn: wat let de CDNA om hier een leidende rol in te gaan spelen? De CDNA is daar juist voor opgericht, toch?
 
Vincent, ook die stap hoort erbij. Wat zou je ervan zeggen om met een aantal belangstellenden in de komende winter een aantal dagen naar Rugen e.o. te gaan? Dan ben je in een gebied waar beide ondersoorten voorkomen en kun je met een aantal mensen toch wel een aantal stappen zetten m.b.t. de juiste determinatiecriteria. En wie weet wil Thomas Heinicke best wel een aantal Nederlanders wat rondleiden en met hun in het veld in discussie gaan over de determinatiecriteria. Rügen ligt ca. naast de deur & genoeg vogelaars gaan erheen om bv naar Kraanvogels te kijken.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Steven Wytema op november 29, 2010, 12:26:35 pm
vooruitlopend op de reactie van de CDNA lijkt het mij al heel wat als waarneming.nl de taigarietgans een niveautje upgrade in zeldzaamheid.
(van vrij algemeen naar zeldzaam). zeldzame soorten (pestvogel, waterspreeuw etc) zijn veelal nog geeneens CDNA-beoordeelsoorten (vaak vet rood)


wrn-admins? is daar al een topic over in het voor ons onzichtbare admin-forum toevallig?  :angel:
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op november 29, 2010, 13:21:37 pm
We zijn inderdaad weer in overleg over wat we met waarnemingen van taigarietgans gaan doen, jouw (wat mij betreft goede) voorstel staat daar inmiddels bij.
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op november 29, 2010, 13:48:52 pm
Kan iemand hier wat over zeggen: Werd uit de lezing een beetje duidelijk hoe variabel Toendra en vooral   ook Taiga is? En hoe zit het met contactzones (scherp of geleidelijk)?

Is er ergens een samenvatting van de lezing in te zien?
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 14:10:33 pm
Triturus: "Kan iemand hier wat over zeggen":
 
(1): "Werd uit de lezing een beetje duidelijk hoe variabel Toendra en vooral ook Taiga is?" Nee. Volgens Thomas Heinicke goed van elkaar te onderscheiden. Eerst IN HET VELD familieverbanden uitzoeken: dus wie is de man, wie is de vrouw, gepaard of niet, positie t.o.v. de groep. Daarnaast veel foto's maken.
 
(2): En hoe zit het met contactzones (scherp of geleidelijk)? Niets over gezegd. Wel iets gezegd over vogels die in het allernoordelijkste deel van Scandinavië broeden.

(3): Is er ergens een samenvatting van de lezing in te zien? Nee. Zie http://www.sovon.nl/default.asp?id=906 Veel van wat Thomas presenteerde staat al op internet etc. Vaak verschijnen samenvattingen van dergelijke lezingen later in Limosa. Soms worden lezingen ook uitgebouwd tot een apart artikel.

 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 14:22:30 pm
Citaat
Wanneer we redelijk streng zijn in de leer, zou het mij niet verbazen wanneer het aantal 'aanvaardbare' taiga's in NL aardig in de buurt komt van gemiddeld 2 per jaar.

Maar dat is dan dus nog steeds te veel om als CDNA zeldzaamheid te worden beschouwd.
 
Vergelijk de populaties Dwerggans (in het NW van zijn verspreidingsgebied misschien 1000?) en Taiga Rietgans (60.000) eens met elkaar, denk je nu echt dat het er maar 2 per jaar zijn in NL (ganzenland bij uitstek). Ik niet.
 
Ik denk persoonlijk dat het hele Rietganzen complex (Taiga en Toendra) op termijn op de schop gaat. Volgens mij zijn er net als bij Grote en Kleine Canadeze gans (zie Hanson) populaties welke gebonden zijn aan een bepaald broedgebied (een rivier, een vallei etc) en dze zijn soms individueel te herkennen als groep omdat ze trouw zijn aan dat gebied en daar steeds terugkeren en met elkaar broeden. Dat zou verklaren dat er zo veel verschillende soorten vogels zijn met subtiele kenmerken die in groepen met elkaar optrekken, maar zich wel bij elkaar aansluiten in de winter.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 29, 2010, 14:39:20 pm
Retranchement vogels zijn me omwille van de Kleine riet en de 'korte' halzen van de meerderheid der vogels (Kleine riet niet heel veel kleiner)dubieus geworden.
Er zit welhaast geen enkele recht toe recht aan Taiga riet tussen al die foto's: Een echte sigarenband verzameling is het!


Edit: Met 'al die foto's' verwijs ik naar 'alle Taigarietfoto's' De retranchement foto's zitten in hetzelfde mapje op dezelfde datum als de Taiga's in Groningen; ook dat is een beetje 'glad'
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op november 29, 2010, 15:14:45 pm
Bedankt Klaas. Het lijkt me toch gevaarlijk om keiharde ID conclusies te trekken zonder het complete plaatje te hebben. Zoals ik het nu begrijp zijn de kenmerken niet gelinkt aan de daadwerkelijke herkomst van de vogels maar puur gebaseerd op klassificaties van overwinterende vogels (en uit maar een klein stukje van het overwinteringsgebied). Of heb ik het mis?
Titel: Re: rietgans, again...
Bericht door: rinsevdvliet op november 29, 2010, 15:25:04 pm
Weet dat de officiële definitie van een indiensoort voor het CDNA is dat deze minder dan twee maal per jaar in NL wordt gezien.
 
Groet Max

 
Is dat niet het geval dan?

Kan iemand hier wat over zeggen: Werd uit de lezing een beetje duidelijk hoe variabel Toendra en vooral   ook Taiga is? En hoe zit het met contactzones (scherp of geleidelijk)?

Is er ergens een samenvatting van de lezing in te zien?

Ik kreeg de indruk dat TH suggereerde dat http://nou.natuurinfo.nl/website/ardea/ardea_show_article.php?nr=341 (http://nou.natuurinfo.nl/website/ardea/ardea_show_article.php?nr=341) nog altijd een een goede indruk geeft van de realiteit. Ben benieuwd hoe, indien de CDNA het taxon gaat beoordelen, er met type 1C en vooral 1D zal worden omgegaan.
 
 

 
Rinse
Titel: Re: rietgans, again...
Bericht door: Adri Clements op november 29, 2010, 15:44:57 pm
Vergelijk de populaties Dwerggans (in het NW van zijn verspreidingsgebied misschien 1000?) en Taiga Rietgans (60.000) eens met elkaar, denk je nu echt dat het er maar 2 per jaar zijn in NL (ganzenland bij uitstek). Ik niet.

Niet mee eens. Beide soorten kunnen veel meer in gedrag (plaatstrouw) verschillen dan je denkt. De grote concentratie taiga's zijn in het uiterste NO van Duitsland te vinden. Thomas H. vertelde dat hij ook op potentiële plekken ten W-ZW-Z heeft gezocht... 0 taiga's gevonden. Verder ten westen dan deze plek alleen 2 groepen langs oostkust van GB. Het is mogelijk dat er vanuit de concentratie taiga's in NO duitsland een groepje ri. ZW vliegt, maar kans is erg klein. Daarvoor is felle kou en sneeuw nodig, meer nog dan in het afgelopen decennium.
Optie 2 is een dwalende groep die in NL neerstrijkt ipv. langs oostkust GB. Gezien de plaatstrouw in de afgelopen jaren lijkt me die kans ook erg klein.
 
Een aantal afbeeldingen (bijv. over de 4 typen taiga's en toendra's) op de presentatie van TH zijn trouwens te vinden in het artikel wat Rinse hierboven linkt.
 
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 29, 2010, 16:07:35 pm
Bedankt Klaas. Het lijkt me toch gevaarlijk om keiharde ID conclusies te trekken zonder het complete plaatje te hebben. Zoals ik het nu begrijp zijn de kenmerken niet gelinkt aan de daadwerkelijke herkomst van de vogels maar puur gebaseerd op klassificaties van overwinterende vogels (en uit maar een klein stukje van het overwinteringsgebied). Of heb ik het mis?


Wat betreft westelijke vogels denk ik dat je het mis hebt omdat Taiga Rietgans een soort is die zijn verspreiding heeft in de Taiga zone van (reeds) Scandinavie en al is het voor ons als 'jonge onderzoekers' zaak dat we fris de kwestie onder de loep nemen, toch zijn deze vogels makkelijk voor ons te kennen.
Wat betreft de Toendra rietgans is weliswaar toegang tot de broedgebieden een grotere belemmering en van zowel Taiga als Toendra weten we niet precies de oost grens van hun verspreiding.
Maar ik zou zo zeggen...oefen materiaal te over op dit ogenblik binnen onze landsgrenzen.


Wat wel zo is, is dat aan de oostkant van het complex van Toendra serrirostris ons een mogelijk maar onbekender taxon voorschoteld, er zwartbek fabalis, nog meer naar het oosten moeten zijn die onder de naam johanseni hun bestemming leken te hebben en tot slot de knoeperd Middendorffii ook nog mee zou kunnen doen.


Ons probleem bestond voornamelijk door de perikelen van 'de jonge onderzoeker' en niet zozeer door ŕl te grote onbekendheid bij autoriteiten op het gebied van rietganzen.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 16:18:28 pm
Bedankt Klaas. (...). Zoals ik het nu begrijp zijn de kenmerken niet gelinkt aan de daadwerkelijke herkomst van de vogels maar puur gebaseerd op klassificaties van overwinterende vogels (en uit maar een klein stukje van het overwinteringsgebied). Of heb ik het mis?

 
Yep. Je hebt het dus niet mis & begrijpt het dus goed.
 
Het gedegen artikel in Ardea staat dus nog steeds recht overeind (in dat artikel worden wel een aantal flinke slagen om de arm gehouden).
 
Maar de nieuwe theorieën van Leo van den Bergh (zie zijn reeks artikelen in onder andere 'Het Vogeljaar') lijken dus, vooral door gebrek aan bewijsplaatjes etc. niet langer een reële optie te zijn.
 
Klaas
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 29, 2010, 16:34:51 pm
Sorry hoor, in Fenno Scandinavie hebben ze Taiga Rietgans nog op het menu staan en anders op de schoorsteenmantel. Zouden die nog problemen met kenmerken hebben? Ik geloof d'r  niks van.
En dan beamen dat kenmerken puur in overwinteringsgebieden vergaard worden...zware overdrijving zou ik dit willen noemen.
Thomas heeft toch wel wŕt over broedgebieden verteld? Hij gebruikte ook het woord 'Russen' en 'Zweden'
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op november 29, 2010, 18:16:13 pm
Citaat
Sorry hoor, in Fenno Scandinavie hebben ze Taiga Rietgans nog op het   menu staan en anders op de schoorsteenmantel. Zouden die nog problemen   met kenmerken hebben? Ik geloof d'r  niks van. En dan beamen dat kenmerken puur in overwinteringsgebieden vergaard worden...zware overdrijving zou ik dit willen noemen.

Maar met zo'n opzet mis je als nog veel van de variatie binnen de taxa toch? En een deel van die variatie zou je wel op de Europese overwinteringsgrondenkunnen verwachten.

  Het lijkt me tricky om harde conclusies te hangen aan slechts een deel van de grote rietganzen populatie waarvan je eigenlijk maar weinig over de herkomst weet. Volgens het Ardea artikel is er overlap in de vogels op basis van bouw. Misschien als je rekening houdt met geslacht en leeftijd dat deze overlap minder wordt, maar helemaal verdwijnen zal die toch niet. De variatie qua tekening is aanzienlijk. (Hoe zou dat met geluid zitten?) Je moet toch weten wat voor geographisch signaal er in die zaken zit voor je beesten/groepen echt kan gaan labellen?

Overigens vind ik het raar om zaken als' ze zitten altijd in een groep' en 'ze mengen nooit' als ID criteria mee te nemen. Is er iets speciaals aan grote rietganzen dat ze altijd minimaal met z'n tweeen zijn? Mocht een eenling moeten kiezen uit op een kaal veld of in een groepje onderganzen staan zou ie dan niet voor het laatste kiezen? Dit is natuurlijk zeker van toepassing als je het hebt over dwaalgasten!
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op november 29, 2010, 18:24:17 pm
Tjonge, mijn zomerslaap is abrupt ten einde. Lützen, kom je ook weer uit je hol?
 
@ Klaas: Beoordeling door de CDNA lijkt enerzijds aantrekkelijk. Afgelopen winter hadden we tenslotte maar één groepje overduidelijke Taiga's (plus de vogels van Retranchement, Oosterhesselen en o.m. losse exemplaren in Midden-Drenthe). En volgens mij zou de CDNA ook als er meer gevallen per winter boven water zouden komen, daar best een uitzondering kunnen maken gezien de 'heikelheid' van dit thema. Maarrrrrrr: op basis van welke criteria moet de CDNA oordelen? De blauwe ogen van Thomas Heinicke? Zoals Ben terecht opmerkt en eerder in dit draadje ook al gezegd is: er is zonder twijfel meer onderzoek nodig naar herkomst en genetische samenstelling van het rietganzencomplex. Zonder dat blijft het subjectief. En dreigt de Taigarietgans de enige soort te worden die door de CDNA 'op jizz' beoordeeld wordt...
 
@ Gerd: je serveert de vogels van Oosterhesselen wel heel makkelijk af. Dat het andersoortige beesten zijn dan die van Woldendorp zie zelfs ik, maar dat het iets bijzonders is, zal iedereen die weleens naar rietganzen kijkt beamen. Niet voor niets ben ik de volgende dag direct gaan zoeken. Dat dit 'gewoon Toendra's' zijn, wil er bij mij niet in.
 
@ Max: Dwerg- en Taigarietgans over één kam scheren lijkt me appels met peren vergelijken. Dat de soort algemener is door Heinicke wordt gesuggereerd zou ik graag van je aannemen - mits je nu eindelijk eens met bewijzen voor die stelling op de proppen zou komen...
 
@ Ben: Mee eens v.w.b. je opmerking over de groepssamenstelling. Er is hier hopelijk niemand die de vogels van Woldendorp in twijfel trekt. Maar verrassing: hoewel me na lang observeren wel de familiebanden duidelijk werden, zaten ze wel degelijk verspreid tussen de Grauwe, Kol-, Toendrariet- en Kleine Rietganzen.
Titel: Re: rietgans, again...
Bericht door: Marnix op november 29, 2010, 18:44:50 pm
Wat ik me afvraag is hoe vaak Thomas Heinicke in NL naar Taigarietganzen gezocht heeft?
Is dat duidelijk geworden tijdens de lezing? Is dat één of twee keer geweest of vaker? En in welke periode dan? Ook in de piek tijd voor de soort in noord Duitsland in januari? En lag de focus tijdens die zoektochten op het vinden van Taigarietganzen of het aflezen van halsbanden van Toendrarietganzen (die Heinicke zelf ringt)?
 
Het punt dat Taiga's zeldzamer zijn als door sommige gedacht lijkt me duidelijk (en terecht!). Zulke vogels als die Willem-Jan Fontijn afgelopen winter bij Woldendorp gevonden heeft heb ik de afgelopen 10-15 jaar niet meer gezien. Maar de stelling dat er naast die vogels en enkele andere vogels er geen andere Taiga's in NL zijn gezien lijkt me ook wat kort door de bocht.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 20:18:34 pm
Wat ik me afvraag is hoe vaak Thomas Heinicke in NL naar Taigarietganzen gezocht heeft? Is dat duidelijk geworden tijdens de lezing? Is dat één of twee keer geweest of vaker? En in welke periode dan? Ook in de piek tijd voor de soort in noord Duitsland in januari? En lag de focus tijdens die zoektochten op het vinden van Taigarietganzen of het aflezen van halsbanden van Toendrarietganzen (die Heinicke zelf ringt)?

hoi Marnix,
 
Ja, Thomas heeft dit goed uitgelegd tijdens zijn hoofdlezing. Een eenmalig bezoek van ik dacht enkele dagen in januari, ik dacht in 2009 en m.i. is hij toen samen met Kees Koffijberg alle locaties in Nederland afgegaan waar volgens de dikke stapel Sovon rapporten grote(re) groepen Taigarietganzen voorkomen. En natuurlijk, dit is dan dus een momentopname. Maar je moet ergens beginnen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 20:48:48 pm
Het lijkt me tricky om harde conclusies te hangen aan slechts een deel van de grote rietganzen populatie waarvan je eigenlijk maar weinig over de herkomst weet. Volgens het Ardea artikel is er overlap in de vogels op basis van bouw. Misschien als je rekening houdt met geslacht en leeftijd dat deze overlap minder wordt, maar helemaal verdwijnen zal die toch niet. De variatie qua tekening is aanzienlijk. (Hoe zou dat met geluid zitten?) Je moet toch weten wat voor geographisch signaal er in die zaken zit voor je beesten/groepen echt kan gaan labellen?

Overigens vind ik het raar om zaken als' ze zitten altijd in een groep' en 'ze mengen nooit' als ID criteria mee te nemen. Is er iets speciaals aan grote rietganzen dat ze altijd minimaal met z'n tweeen zijn? Mocht een eenling moeten kiezen uit op een kaal veld of in een groepje onderganzen staan zou ie dan niet voor het laatste kiezen? Dit is natuurlijk zeker van toepassing als je het hebt over dwaalgasten!

Het Ardea artikel is onder andere zo gedegen omdat er altijd onderscheid wordt gemaakt tussen man en vrouw. En er is inderdaad overlap in de kenmerken waarnaar gekeken is. Dat wordt niet verbloemd. Niet voor niets staat 'two types of the Bean Goose' in de titel. Wel is het artikel gebaseerd op grootschalige vangsten. Dan vang je een (grote) groep en heb je geen idee van familieverhoudingen. Wel grote steekproeven, maar alleen data van vogels in de hand zonder dat je weet wie bij wie hoort.
 
Thomas gaf aan dat er ook verschillen in geluid waren en liet dit zelfs horen.
 
Bij waarnemingen in het veld heb je gewoon het grote voordeel dat je veel meer informatie kunt verzamelen. Dus waarom zou je hier niet naar kijken? Tuurlijk, een enkele afgedwaalde Taigarietgans kan alleen zijn, maar dat hoeft natuurlijk niet.
 
Meeuwen (om maar eens een voorbeeld te noemen) trekken jaarrond niet als familie op; ganzen wel. Gewoon kijken & vaststellen of de vogel gepaard is (of niet), en vervolgens kijken (in het geval je hebt kunnen vaststellen dat hij gepaard is) of het qua gedrag een man is of een vrouw. Nou, dan heb je al een aantal stappen gezet.
 
Thomas gaf ook nog aan dat een gemiddelde vrouw Taigarietgans qua maten etc overeenkwam met een gemiddelde man Toendrarietgans.
 
Eigenlijk erg jammer dat je niet bij deze lezing aanwezig kon zijn. Bovendien had je dan na afloop Thomas het hemd van zijn lijf kunnen vragen (hij was de hele dag aanwezig). Maar vraag rustig verder.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 29, 2010, 20:53:23 pm

Vincent, ook die stap hoort erbij. Wat zou je ervan zeggen om met een aantal belangstellenden in de komende winter een aantal dagen naar Rugen e.o. te gaan? Dan ben je in een gebied waar beide ondersoorten voorkomen en kun je met een aantal mensen toch wel een aantal stappen zetten m.b.t. de juiste determinatiecriteria. En wie weet wil Thomas Heinicke best wel een aantal Nederlanders wat rondleiden en met hun in het veld in discussie gaan over de determinatiecriteria. Rügen ligt ca. naast de deur & genoeg vogelaars gaan erheen om bv naar Kraanvogels te kijken.
 
Groetjes, Klaas

Thomas gaf aan dat er ook verschillen in geluid waren en liet dit zelfs horen.



Helaas kan ik deze winter niet vanwege werk en studie. Maar voor volgende kerstvakantie zat dit idee zeker in mijn hoofd. Twee weken Rügen en Zuid-Zweden lijken me wel wat! Wat wel belangrijk is, is van tevoren een duidelijke scoringstabel opstellen, zodat je data kunt vergaderen. Anders kom je met een heel wolk foto's en notities terug die vervolgens niet systematisch te behandelen zijn. Maar dat hoef ik je natuurlijk niet te vertellen!

De nieuwe uitdaging voor The Sound Approach, zoals ook Theo M. al suggereerde! Er valt vast wel wat te doen met roepfrequenties in combinatie met een duidelijke beschrijving van de betreffende vogels. Kortom, het totaalplaatje.

Zelf ben ik begonnen om alle kenmerken uit de literatuur in een overzicht te proppen. Het zou mooi zijn als TH zoiets kan corrigeren en valideren. Ik ben nog op zoek naar een kopie van Oriolus 1986 met daarin een verhaal van Huyskens over het rietganzenprobleem: Huyskens, P.R.G. 1986. The Bean Goose problem in Eu-rope. Oriolus 52: 105-256.

Verder is het natuurlijk verleidelijk om taigarietganzen te willen herkennen zonder verder al te veel naar zwemvliezen te willen kijken. Om 'm maar met de DB van 2014 in de hand voor je lijst te kunnen aantikken. Op die manier kom je ook niet achter de variatie in kolgans. Het gaat langdurige observatie kosten.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op november 29, 2010, 20:57:58 pm
@ Klaas: Beoordeling door de CDNA lijkt enerzijds aantrekkelijk. Afgelopen winter hadden we tenslotte maar één groepje overduidelijke Taiga's (plus de vogels van Retranchement, Oosterhesselen en o.m. losse exemplaren in Midden-Drenthe). En volgens mij zou de CDNA ook als er meer gevallen per winter boven water zouden komen, daar best een uitzondering kunnen maken gezien de 'heikelheid' van dit thema. Maarrrrrrr: op basis van welke criteria moet de CDNA oordelen? De blauwe ogen van Thomas Heinicke? Zoals Ben terecht opmerkt en eerder in dit draadje ook al gezegd is: er is zonder twijfel meer onderzoek nodig naar herkomst en genetische samenstelling van het rietganzencomplex. Zonder dat blijft het subjectief. En dreigt de Taigarietgans de enige soort te worden die door de CDNA 'op jizz' beoordeeld wordt.
 
Mee eens v.w.b. je opmerking over de groepssamenstelling. Er is hier hopelijk niemand die de vogels van Woldendorp in twijfel trekt. Maar verrassing: hoewel me na lang observeren wel de familiebanden duidelijk werden, zaten ze wel degelijk verspreid tussen de Grauwe, Kol-, Toendrariet- en Kleine Rietganzen.

Kijk, een goede & gedegen waarnemer die de vogels van Woldendorp net zolang is blijven bekijken totdat hij eindelijk doorhad hoe de familieverbanden lagen. Dat is dus de manier hoe het moet. Er is toch niets mee mis als de desondanks toch verspreid tussen de andere soorten zaten? Dat is wat je hebt vastgesteld & het is natuurlijk geen wet van Meden & Perzen (en zeker geen valide determinatiekenmerk) dat Taigarietganzen per definitie apart moeten zitten. Het kan een -eerste- aanwijzing zijn voor iets 'vreemds.'
 
Pieter-Geert, erg jammer dat je ook niet bij deze lezing en bij de workshop was. Ik geloof Thomas zeker niet op zijn blauwe ogen hoor. Maar er is een aantrekkelijk alternatief: gewoon zelf een kijkje nemen in het voormalige Oost-Duitsland in die gebieden waar volgens Thomas Heinicke grote groepen Taigarietganzen zitten en gewoon zelf beoordelen of het allemaal klopt. En zo'n tripje kun je natuurlijk heel goed gezamenlijk met een aantal vogelaars ondernemen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 21:23:11 pm
PieterGeert,
 
Citaat

@ Max: Dwerg- en Taigarietgans over één kam scheren lijkt me appels met peren vergelijken (Waarom eigenlijk??). Dat de soort algemener is door Heinicke wordt gesuggereerd zou ik graag van je aannemen - mits je nu eindelijk eens met bewijzen voor die stelling op de proppen zou komen...

Volgens mij lees je mijn posting niet goed. Ook de nu op eens heilig bevonden Heinicke zegt dat er Taiga's in NL op foto's terug te vinden zijn (ik begreep dat hij niet op hoeveel en welke in is gegaan). Het door jou gevraagde "bewijs" wordt hiermee gegeven, immers bij mij gaat het om aan te tonen dat het er meer dan twee per jaar zijn..
Het is overigens moeilijk om "bewijs" te geven als de aangevoerde bewijsplaten door andere weer weerlegd worden (Retranchement) en dat is nu juist de kern van het probleem.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 29, 2010, 21:56:24 pm

* Iedereen weet hoe zeldzaam Dwergganzen zijn (en dan bedoel ik niet de project populaties). Dwerggans komt jaarlijks met 10+ ex. in NL voor welke waarschijnlijk niet betrekking hebben op projectvogels (zitten in gebieden waar geen projectvogels zitten en zijn altijd ongeringd). Dwerggans is geen CDNA indiensoort. Ik kan me niet voorstellen op basis van de laatste populatieschattingen van Taiga Rietgans dat deze zeldzamer is dan Dwerggans. Het "opwaarderen" van Taiga Rietgans tot een CDNA indiensoort lijkt mij dus voorlopig niet logisch. Weet dat de officiële definitie van een indiensoort voor het CDNA is dat deze minder dan twee maal per jaar in NL wordt gezien.
 
Groet Max

Zeldzaamheid hangt niet af van populatiegrootte. Het gaat bij ganzen vooral om flyways, stops en nog eens flyways. Ross' gans overstijgt qua aantallen geloof ik ook dwerggans, maar om die nu gelijk minder zeldzaam te noemen. De flyway van Ross'gaat nu eenmaal niet naar Nederland.

Thomas Heinicke liet zaterdag zien dat vanaf de jaren '80 taigarietganzen (van Scandinavische origine) duidelijk minder ver zijn gaan trekken en nauwelijks nog in Nederland komen. Dat wordt gestaafd door bevindingen van ganzenvangers en de afname van ringmeldingen. En door langjarig onderzoek van Leif Nilsson in Zweden.

Ik heb net een mail met daarin tien linkjes naar bekende probleemgevallen en duidelijke groepjes op waarneming.nl naar Thomas Heinicke gestuurd. Ik hoop dat hij reageert.
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 29, 2010, 21:56:34 pm
Kan iemand hier wat over zeggen: Werd uit de lezing een beetje duidelijk hoe variabel Toendra en vooral   ook Taiga is? En hoe zit het met contactzones (scherp of geleidelijk)?

Is er ergens een samenvatting van de lezing in te zien?

De variatie in snavelkleur kwam wel langs; Taiga heeft 4 'types' snavelkleur waarbij weinig geel in 20% voorkwam en helemaal geel in 50-60%.

Toendra heeft ook 4 'types' gekregen en heeft in ik meen 10 procent veel geel, bijna altijd veel zwart en vaak een gele band, soms verbonden langs de snijrand naar de basis.

Contactzones zie elders hier.

THeo
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 29, 2010, 21:58:13 pm
Taiga komt  nu aardig overeen met Groenlandse Kolgans, qua zeldzaamheid en qua keuze in vaste overwinteringsplekken (maar dan elders natuurlijk.
Maar in een strenge winter zitten ze heus wel weer in NO Groningen.

Theo
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 22:10:00 pm
Citaat
Ross' gans overstijgt qua aantallen geloof ik ook dwerggans, maar om die nu gelijk minder zeldzaam te noemen. De flyway van Ross'gaat nu eenmaal niet naar Nederland.

eeeh lees deze nog even terug en overdenk het nog even...Ross Gans is een Noord Amerikaanse Dwaalgast (volgens sommige), Dwerggans broedt net als Taiga R. in Scandinavie. Flyway's worden beinvloed door carrier species die verdwaalde vogels meevoeren. Zeker wanneer weer en voedselsituaties veranderen/verslechteren. Hoe groter de populatie van een soort hoe groter de kans dat het hogere aantal vogels van een soort hier naar toe verdwaalt (mits uit hetzelfde broedgebied niet met een oceaan ertussen...).
 
Citaat

Maar in een strenge winter zitten ze heus wel weer in NO Groningen
Maar waarom nou alleen daar?? ganzen vliegen in een dag heel NL over (zie de Ross Gans van Friesland die een dag latwer in Belgie zat, en waarom niet bij sneeuw vanuit de UK naar de kust (Retranchement)?
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 29, 2010, 22:14:17 pm
Wat nieuwe dingen wat betreft ID die langskwamen tijdens de workshop:

- 1ste winter toendrarietgans heeft minder geel in de snavel dan 1ste winter taigarietgans.
- De nagel (voorste deel van bovensnavel) is rond bij taigarietgans en ovaal bij toendrarietgans.
- ringers gebruiken in de hand nog steeds het kenmerk van het aantal snijtandjes in de onderkaak. Taiga heeft er meer. Het kenmerk is geloof ik als eens genoemd in dit topic en komt uit een publicatie van 1905. Ik zoek het nog even op.

http://www.youtube.com/watch?v=3KbVp1_jIbU (http://www.youtube.com/watch?v=3KbVp1_jIbU) is met name interessant vanaf minuut 4.54 en 7.10. Vanaf 9.05 is te zien dat ringers nog steeds de tabel van
Burgers e.a. (1991) gebruiken, die TH ook liet zien in de presentatie.



Citaat

eeeh lees deze nog even terug en overdenk het nog   even...Ross Gans is een Noord Amerikaanse Dwaalgast (volgens sommige),   Dwerggans broedt net als Taiga R. in Scandinavie. Flyway's worden   beinvloed door carrier species die verdwaalde vogels meevoeren. Zeker   wanneer weer en voedselsituaties veranderen/verslechteren. Hoe groter de   populatie van een soort hoe groter de kans dat het hogere aantal vogels   van een soort hier naar toe verdwaalt (mits uit hetzelfde broedgebied   niet met een oceaan ertussen...).

Een betere illustratie had ik even niet voorhanden. Ik bedoelde duidelijk te maken dat ik het niet eens ben met de redenering dat hoe groter de populatie van een soort is, hoe groter de kans is dat een deel ervan naar ons afdwaalt.

Dan ga je uit van een één-op-éénrelatie tussen populatiegrootte en vagrancy-potential. De bewegingen van ganzen hangen denk ik af van veel meer factoren. Zo is de toendrarietgans in Hongarije 's winters inmiddels 'zeldzamer' en bij ons stijgen de aantallen al jaren. Toch wordt de wereldpopulatie als stabiel verondersteld.
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 29, 2010, 22:16:43 pm
Bedankt Klaas. Het lijkt me toch gevaarlijk om keiharde ID conclusies te trekken zonder het complete plaatje te hebben. Zoals ik het nu begrijp zijn de kenmerken niet gelinkt aan de daadwerkelijke herkomst van de vogels maar puur gebaseerd op klassificaties van overwinterende vogels (en uit maar een klein stukje van het overwinteringsgebied). Of heb ik het mis?

Maar T.H. heeft de Taiga uittentreure bekeken, ook toen ze nog geringd waren dacht ik.
Hij is ook in Polen geweest, Denemarken en Zweden.
Hij gaf een heel aardig idee/ uitleg over het hele plaatje van de westerse vogels.

Hij gaf vooral aan dat hij determineert met alle kenmerken, dus de set als geheel, niet op 1 kenmerk.
Dus ik denk dat Thomas meer heeft dan blauwe ogen.
Hij kwam me over als serieus, precies en al jaren vastgebeten in het probleem.

Zijn determinatiekenmerken waren erg overtuigend.
Hij liet van toendra de variatie zien en vooral grote mannetjes kunnen leiden tot problemen.
Mannetjes Toendra hebben vaak meer geel dan vrouwtjes.

Theo
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 22:22:32 pm
Theo,
 
Zonder Heincke af te vallen:
Citaat
Hij kwam me over als serieus, precies en al jaren vastgebeten in het probleem.
Dat komt Leo van de Bergh ook en weet je hoeveel tijd die er in gestoken heeft.
 
Ik heb inmiddels al minimaal twee Taiga grootheden in NL naast Leo gevolgd, waarvan je nu nooit meer wat hoort en een werd ontmaskerd door nekringen van zijn Taiga's die uit de het broedgebied van de Toendra's bleken te komen (zie de opmerking van Ben..)
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 29, 2010, 22:27:17 pm
Theo,
 
Zonder Heincke af te vallen:
Citaat
Hij kwam me over als serieus, precies en al jaren vastgebeten in het probleem.
Dat komt Leo van de Bergh ook en weet je hoeveel tijd die er in gestoken heeft.
 
Ik heb inmiddels al minimaal twee Taiga grootheden in NL naast Leo gevolgd, waarvan je nu nooit meer wat hoort en een werd ontmaskerd door nekringen van zijn Taiga's die uit de het broedgebied van de Toendra's bleken te komen (zie de opmerking van Ben..)
 
Groet Max

Tsja, jammer dat er te weinig mensen bij waren.
Zijn foto's die hij liet zien uit Duitsland waren erg overtuigend.

Theo
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 29, 2010, 22:39:21 pm
Theo,
 
je hebt gelijk, ik had er natturlijk bij moeten zijn om een goed oordeel te geven en ik hoop dat die Heinicke (moet steeds aan bier denken) kan helpen met het oplossen van het ID misterie.
 
Ik heb als persoonlijk projectje een (groepje?) Taiga's te zien deze winter die door iedereen worden omarmt, dus op de RBA ermee zou ik zeggen.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op november 29, 2010, 23:14:51 pm
Misschien kwam ik wat negatief over, dat was niet mijn bedoeling. Hulde aan Heincke voor zijn uitpluis werk! Ik ben benieuwd hoe het in praktijk gaat werken. Kunnen jullie nu elke dwaal Taiga in een groep Toendra's afmaken? Ik hoop dat "het is niet helemaal een Taiga dus het moet wel een Toendra zijn" overbodig is geworden.

Het is meer dat ik me afvraag wat de twee clusters (en eventuele subgroepen daarbinnen?) nou precies vertegenwoordigen. Is er echt nog steeds zo'n duidelijke dichotomie bij die rakkers als je er op grotere schaal naar kijkt, of hou je misschien geen cluster meer over, of heb je er juist meer? Dat soort dingen.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op november 29, 2010, 23:25:47 pm
Ik bedoelde in mijn vorige post de plaat op blz. 10 van deze discussie. Oates, E. W,- On the species of Bean-geese. Bombay, J. Nat. Hist. Soc.. 1906 (38-50, 1 pi.).

Heinicke noemde volgens mij dat fabalis tussen de 21 en 29 snijtanden heeft en rossicus gemiddeld minder. Hij gebruikt dat kenmerk bij het ringen. Oates heeft arvensis 26 snijtanden gegeven en serrirostris 21. Dat heeft hij in 1906 vast niet voor niets gedaan.

O ja, ik heb halverwege vorig jaar een stukje geschreven voor het jaarverslag van de regionale vogelwacht. Het gaat hierbij als bijlage. Er zitten wat fouten in, nu ik het nalees merk ik ze op. Uiteraard is het afgestemd op het publiek. Qua data passen twee van de drie beschreven vogels niet echt in het door TH geschetste migratiebeeld.
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op november 30, 2010, 00:22:15 am
. Kunnen jullie nu elke dwaal Taiga in een groep Toendra's afmaken?


Beste Ben, ik denk dat we van deze eis en benadering  juist af moeten, en ben van mening dat juist bij dit soort vogels de gedraging dat ze veelal binnen familieverband blijven wel degelijk zwaarwegend is. Niet alleen vanwege hun gedraging maar ook bezien vanuit een historisch kader van ons vogelaars; wij hebben immers vele familiegroepen zien passeren.
Is het dan onmogelijk een enkeling te identificeren? Ik geloof dat ook enkelingen zeer degelijk te identificeren zijn, zeker door kenners, maar dat de praktijk uitwijst dat ietwat afwijkende individuen niet gemangeld zouden moeten worden vanwege een subjectieve 'tick honger' (zoals we nu wel wat hebben leren kennen..)


 want welk ander doel dient het, om nou net die ene Taigarietgans er tussen uit te vissen?
Dat is dus volstrekt onbelangrijk, zeker in dit geval waar we een voorheen talrijke wintergast hebben zien verdwijnen.


Die ene Taigarietgans...goeiedag zeg. CONTRACTIE is hier het ware credo..
Titel: Re: rietgans, again...
Bericht door: Cygnus op november 30, 2010, 00:36:19 am
Ik heb inmiddels al minimaal twee Taiga grootheden in NL naast Leo gevolgd, waarvan je nu nooit meer wat hoort en een werd ontmaskerd door nekringen van zijn Taiga's die uit de het broedgebied van de Toendra's bleken te komen (zie de opmerking van Ben..)
 
Groet Max

Dit verhaal van die nekringen ken ik niet, kun je daar iets meer over vertellen?
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op november 30, 2010, 06:09:56 am
Wat ik me afvraag is hoe vaak Thomas Heinicke in NL naar Taigarietganzen gezocht heeft? Is dat duidelijk geworden tijdens de lezing? Is dat één of twee keer geweest of vaker? En in welke periode dan? Ook in de piek tijd voor de soort in noord Duitsland in januari? En lag de focus tijdens die zoektochten op het vinden van Taigarietganzen of het aflezen van halsbanden van Toendrarietganzen (die Heinicke zelf ringt)?

hoi Marnix,
 
Ja, Thomas heeft dit goed uitgelegd tijdens zijn hoofdlezing. Een eenmalig bezoek van ik dacht enkele dagen in januari, ik dacht in 2009 en m.i. is hij toen samen met Kees Koffijberg alle locaties in Nederland afgegaan waar volgens de dikke stapel Sovon rapporten grote(re) groepen Taigarietganzen voorkomen. En natuurlijk, dit is dan dus een momentopname. Maar je moet ergens beginnen.
 
Groetjes, Klaas

Zelf heb ik met name de afgelopen twee winters vele claims nagetrokken in Groningen, Drenthe, Overijssel, Gelderland, Utrecht en Noord-Brabant. In Groningen was het natuurlijk bingo. In Drenthe en Overijssel heb ik enkele zeer interessante beesten (lees: goede kandidaten) gezien. In Gelderland, Utrecht en Noord-Brabant (omgeving Kraaijenbergse Plassen en omgeving Den Bosch) heb ik geen enkele kandidaat-Taiga ontmoet. Collega-rietganzenkijker Emo Klunder (pers. med.) ziet in de veenkoloniën, ooit toch een van de kerngebieden voor deze soort, hooguit enkele Taiga's per jaar. Maar we zoeken deze winter onverdroten voort - volgens Max moeten er tenslotte meer zijn...
 
Ik heb net een mail met daarin tien linkjes naar bekende probleemgevallen en duidelijke groepjes op waarneming.nl naar Thomas Heinicke gestuurd. Ik hoop dat hij reageert.

Goeie actie Albert, ik ben benieuwd!
 
W.b. de 'nieuwe' kenmerken die je noemt: de hoeveelheid geel op de snavel bij 1w's is bij mijn weten inderdaad nieuwe informatie (maar vooralsnog niet gekwantificeerd?), de rest is hier al eens langs gekomen volgens mij. Zowel het aantal 'snijtanden' als de vorm van de nagel vind ik in het veld echter praktisch niet bruikbaar, jij wel? Mocht ik nog eens in Rügen terechtkomen, probeer ik in ieder geval de beschikking te hebben over een microfoon, wie weet ligt daar de sleutel...
 
Overigens verbaast het mij wel dat in Duitsland die tabel van Burgers et al nog steeds gebruikt wordt. Die clustering in snaveltekening is voor zover ik het kan bekijken namelijk volstrekt willekeurig (geeft in combinatie met de percentages hooguit een algemeen beeld) en bovendien ware het te wensen dat er qua snavelvorm maar twee types rondliepen...
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op november 30, 2010, 07:56:53 am
Citaat
volgens Max moeten er tenslotte meer zijn...
of je moet beter zoeken.... :D , als ik jou relaas lees heb je er in ieder geval meer dan twee gevonden (samen met Emo) hetgeen de grens van een CDNA soort dus overstijgt.
 
Persoonlijk denk ik dat Taiga's met enkele 10tallen per jaar NL bezoekt (tel de waarnemingen van door de meeste goed bevonden vogels van vorige winter maar eens op) en dat is heel lang zo (ik zoek elk jaar vanaf 1992 in Limburg (Peel) en vind er nauwelijks goede beesten, wat de soort gelijk stelt met Dwerg, Roodhalsgans (maar beide geen beoordeelsoorten). Begin jaren negentig (toen ik net in Limburg kwam wonen) moest je ook al naar toen bekende gebieden voor Taiga's (o.a. Vugtse Gement nabij de IJzeren Man) om groepjes te zien. Inmiddels zijn ook deze gebieden bevolkt door Toendra's.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Bas vd Burg op november 30, 2010, 09:03:08 am
Ondertussen ben ik de draad behoorlijk kwijt (komt ook omdat ik niet bij de workshop aanwezig kon zijn ivm andere verplichtingen). Is het mogelijk dat er een soortgelijke tabel wordt opgesteld, die Lützen eens heeft gefabriceerd in het andere topic over Tiagarietgans, (topic http://forum.waarneming.nl/smf/index.php?topic=15676.330.html (http://forum.waarneming.nl/smf/index.php?topic=15676.330.html) pagina 12, reactie 357), maar dan aangepast aan de nieuwste inzichten?
 
Ik heb daarom een lijstje gemaakt met de meeste in de literatuur genoemde verschillen tussen Taiga- en Toendrarietgans. Ik ben benieuwd of en welke kenmerken andere waarnemers  hanteren en hoe ze de bruikbaarheid ervan inschatten (even los van hun opinie over de taxonomie). Mocht ik nog een genoemd kenmerk vergeten zijn (goed of slecht bruikbaar dat maakt even niet uit) dat dan hoor ik dat graag. Dit is niet bedoeld als een soort van opiniepeiling, dus mensen die geen veld-ervaring hebben met beide rietgans-(onder)soorten zou ik willen vragen hun mening over de bruikbaarheid voorlopig even voor zich te houden (al staat vragen natuurlijk vrij). Hier de tabel zoals ik die nu heb:

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansKlein, slechts ietsje groter dan Kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank (vooral Scandinavische vogels)Kort, vrij dik
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels oranjegeel gekleurd, echter regelmatig ook merendeels donkerVoor meer dan de helft zwart
OverigRegelmatig met witte veertjes rond snavelbasisGeen witte veertjes rond snavelbasis
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht


Titel: Re: rietgans, again...
Bericht door: Ben Gaxiola op november 30, 2010, 13:07:17 pm
Ondertussen ben ik de draad behoorlijk kwijt (komt ook omdat ik niet bij de workshop aanwezig kon zijn ivm andere verplichtingen). Is het mogelijk dat er een soortgelijke tabel wordt opgesteld, die Lützen eens heeft gefabriceerd in het andere topic over Tiagarietgans, (topic http://forum.waarneming.nl/smf/index.php?topic=15676.330.html (http://forum.waarneming.nl/smf/index.php?topic=15676.330.html) pagina 12, reactie 357), maar dan aangepast aan de nieuwste inzichten?
 
Ik heb daarom een lijstje gemaakt met de meeste in de literatuur genoemde verschillen tussen Taiga- en Toendrarietgans. Ik ben benieuwd of en welke kenmerken andere waarnemers  hanteren en hoe ze de bruikbaarheid ervan inschatten (even los van hun opinie over de taxonomie). Mocht ik nog een genoemd kenmerk vergeten zijn (goed of slecht bruikbaar dat maakt even niet uit) dat dan hoor ik dat graag. Dit is niet bedoeld als een soort van opiniepeiling, dus mensen die geen veld-ervaring hebben met beide rietgans-(onder)soorten zou ik willen vragen hun mening over de bruikbaarheid voorlopig even voor zich te houden (al staat vragen natuurlijk vrij). Hier de tabel zoals ik die nu heb:

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansKlein, slechts ietsje groter dan Kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank (vooral Scandinavische vogels)Kort, vrij dik
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels oranjegeel gekleurd, echter regelmatig ook merendeels donkerVoor meer dan de helft zwart
OverigRegelmatig met witte veertjes rond snavelbasisGeen witte veertjes rond snavelbasis
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht



Geluid   lager dan Grauwe gans       hoger dan Grauwe gans
 
 
Overigens gaf Thomas aan dat bij taiga ca 80 % witte veertjes rond de snavelbasis had, maar dat Toendra het ook kan hebben. Op individueel niveau is het dus geen hard kenmerk, maar als je een groep hebt met een groot deel vogels met witte veertjes rond de snavelbasis dan is het een goede indicatie.
Titel: Re: rietgans, again...
Bericht door: Gert Ottens op november 30, 2010, 13:10:03 pm
Ondertussen ben ik de draad behoorlijk kwijt (komt ook omdat ik niet bij de workshop aanwezig kon zijn ivm andere verplichtingen). Is het mogelijk dat er een soortgelijke tabel wordt opgesteld, die Lützen eens heeft gefabriceerd in het andere topic over Tiagarietgans, (topic http://forum.waarneming.nl/smf/index.php?topic=15676.330.html (http://forum.waarneming.nl/smf/index.php?topic=15676.330.html) pagina 12, reactie 357), maar dan aangepast aan de nieuwste inzichten?
 
Ik heb daarom een lijstje gemaakt met de meeste in de literatuur genoemde verschillen tussen Taiga- en Toendrarietgans. Ik ben benieuwd of en welke kenmerken andere waarnemers  hanteren en hoe ze de bruikbaarheid ervan inschatten (even los van hun opinie over de taxonomie). Mocht ik nog een genoemd kenmerk vergeten zijn (goed of slecht bruikbaar dat maakt even niet uit) dat dan hoor ik dat graag. Dit is niet bedoeld als een soort van opiniepeiling, dus mensen die geen veld-ervaring hebben met beide rietgans-(onder)soorten zou ik willen vragen hun mening over de bruikbaarheid voorlopig even voor zich te houden (al staat vragen natuurlijk vrij). Hier de tabel zoals ik die nu heb:

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansKlein, slechts ietsje groter dan Kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank (vooral Scandinavische vogels)Kort, vrij dik
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels oranjegeel gekleurd, echter regelmatig ook merendeels donkerVoor meer dan de helft zwart
OverigRegelmatig met witte veertjes rond snavelbasisGeen witte veertjes rond snavelbasis
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht



Geluid   lager dan Grauwe gans

En de kenmerken 'snavelkleur' en 'witte veertjes rond de snavelbasis' zijn variabel, niet altijd onderscheidend en dus niet diagnostisch.
 
Gert
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 30, 2010, 20:54:47 pm
Tabel wat aangepast.

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansMan groot, vrouw iets groter dan kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank over de hele lengteKorter, vrij dik, lang bij waken maar dan 'taps' met smaller middendeel
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank en puntig. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels geheel oranjegeel; minder dan de helft met zwartVoor meer dan de helft zwart, oranje overheersend in max 20%
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht
GeluidZwaar en laag, als grauwe, vaak 2-lettergrepigduidelijk hoger, vaak 3-lettergrepig
witte veertjes rond snavelZeer regelmatigMeestal niet
Borstopvallende zwanebult door ingehouden hals als zwaan kan opvallenniet zo

Titel: Re: rietgans, again...
Bericht door: August op november 30, 2010, 21:22:44 pm
http://waarneming.nl/waarneming/view/51123843
Deze zitten bij jou om de hoek Theo ! Zeg het maar
Titel: Re: rietgans, again...
Bericht door: theomuusse op november 30, 2010, 22:09:03 pm
http://waarneming.nl/waarneming/view/51123843 (http://waarneming.nl/waarneming/view/51123843)
Deze zitten bij jou om de hoek Theo ! Zeg het maar

Helaas, had mooi geweest.
Zijn wellicht beestjes die ons al jaren in de luren willen leggen, mij incluis.

Theo
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 01, 2010, 20:36:28 pm
Ik ben nog op zoek naar een kopie van Oriolus 1986 met daarin een verhaal van Huyskens over het rietganzenprobleem: Huyskens, P.R.G. 1986. The Bean Goose problem in Eu-rope. Oriolus 52: 105-256.

hoi Albert,
 
Kan ik je helaas niet aan helpen, want heb ik zelf ook niet. Deze aflevering van Oriolus staat in ieder geval in de tijdschriftenbibliotheek van de NOU (tegenwoordig te raadplegen bij Sovon in Nijmegen; niet meer in Amsterdam!).
 
Zie ook bijgaand gigantisch mooi overzicht van locaties van tijdschriften in Nederland, ooit door Kees Roselaar gemaakt.
http://nou.natuurinfo.nl/website/oud/nou_cs.htm (http://nou.natuurinfo.nl/website/oud/nou_cs.htm)
 
Verder had je het in een andere bijdrage over verschillen in aantallen zaagtandjes in de snavel. Typisch een kenmerk voor vogels in de hand (dus ringers), maar wellicht ook te bestuderen bij balgen in een museum. Het ZMA in Amsterdam heeft vast wel een serietje balgen van Toendra- en Taigarietganzen. En uitkijken naar koppen van (vers) dode Rietganzen en daar eens goed naar dit kenmerk kijken. Trinus Haitjema, ook actief op dit forum, heeft als ringer ook Rietganzen in de hand gehad. Wellicht kan hij je er ook meer over vertellen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 01, 2010, 21:06:43 pm
Als ik het allemaal goed begrijp hebben wij (admins) het een stuk makkelijker gekregen: 99,9% zal gewoon Toendra zijn, daar hoeven we bij wijze van spreken niet eens meer naar te kijken.

Ja. Het is zelfs veel gemakkelijker.
 
Naar schatting zaten er in de winter van 2007/08 maximaal 176.000 Toendrarietganzen gelijktijdig in Nederland en het ging in de winter van 2006/07 om ongeveer 174.000 Toendrarietganzen (bron Sovon-rapporten). En hoeveel 100% zekere Taigarietganzen zijn er in die beide winters in Nederland gezien? Ongeveer 2 gevallen ofzo? Of nix?
 
Dus geen 99,9% (1 op de 1000), maar misschien wel 99,999 en een half % (1 op de 200.000 ofzo; doorstroming niet eens meegerekend) van de gevallen heeft betrekking op Taigarietgans. De default kun je dus gewoon op 'Toendrarietgans' zetten en 'Rietgans spec'. kun je afschaffen (of ergens helemaal achteraan vermelden).
 
Momenteel is Taigarietgans dus vele malen zeldzamer dan bijvoorbeeld Pontische Meeuw. Het gaat hooguit om enkele gevallen per jaar? Misschien waren er de afgelopen tien jaar wel winters met geen enkel geval wat de toets der kritiek van iedereen kan doorstaan (cq waarnemingen die op wat voor manier niet voldoende zijn gedocumenteerd).
 
Bij Zilvermeeuw houdt een 'gemiddelde' waarnemer er ook niet voortdurend rekening mee dat het misschien wel een Pontische Meeuw kan zijn en voer je dus ook niet steeds 'Grote Meeuw' in. Het zijn Zilvermeeuwen en er zullen best wel eens wat Pontische Meeuwen doorheen glippen. Zo gaat het met grootschalige wadvogeltellingen, slaapplaatstellingen en trektellingen ook.
 
Blijft nog wel de vraag staan hoe je als waarneming.nl moet omgaan met:
(1) bestaande (= al ingevoerde) waarnemingen van Taigarietganzen van pakweg de afgelopen 10 jaar, en
(2) nieuwe waarnemingen van Taigarietganzen.
 
Je zou een eerste stap kunnen zetten door alle nieuwe waarnemingen (bijvoorbeeld met ingang van 1 december 2010) wel te gaan beoordelen etc. Wellicht een groepje mensen formeren die deze gevallen gaan beoordelen. En bij zo'n eerste stap ook een lijst gaan maken van alle kenmerken die genoteerd moeten worden, wil een geval in aanmerking komen voor aanvaarding. Kan ook best in de vorm van een 'groeiend iets' cq al doende leert men.
 
Je kunt natuurlijk gaan wachten op het CDNA. Maar het CDNA stelt zich tot nu toe op het standpunt dat Taigarietgans niet zeldzaam genoeg is om 'beoordeelsoort' te zijn / te worden.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 01, 2010, 23:42:47 pm
Op de schaal van aantallen bepalen is het natuurlijk ok om Toendra als default te beschouwen, maar voor twijfelgevallen, op individueel niveau, moet je toch zeker de catergorie rietgans sp. behouden lijkt mij. Als je niet uit een beest komt is daar niks mis mee. Je hoeft toch niet overal een specifieke naam op te plakken, sterker nog, dat zou zonde zijn.

Titel: Re: rietgans, again...
Bericht door: Cygnus op december 01, 2010, 23:44:01 pm
Zelf ben ik begonnen om alle kenmerken uit de literatuur in een overzicht te proppen. Het zou mooi zijn als TH zoiets kan corrigeren en valideren. Ik ben nog op zoek naar een kopie van Oriolus 1986 met daarin een verhaal van Huyskens over het rietganzenprobleem: Huyskens, P.R.G. 1986. The Bean Goose problem in Eu-rope. Oriolus 52: 105-256.
Deze Rietganzen-special van Oriolus staat bij mij in de boekenkast. Ik wil hem wel scannen, maar neem daar gezien de lengte van het artikel wel even de tijd voor. Iedereen die t.z.t. dit gescande artikel wil ontvangen kan mij het beste zijn of haar e-mailadres via een PB even toesturen.
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 02, 2010, 06:14:04 am
http://waarneming.nl/waarneming/view/51132677 (http://waarneming.nl/waarneming/view/51132677)
 
Ik weet al waar ik zaterdag heen ga...
Titel: Re: rietgans, again...
Bericht door: Ben Gaxiola op december 02, 2010, 09:36:13 am
Kan Hisko of iemand anders er voor zorgen dat taiga's op de voorpagina belanden als rode of donkerrode soort?
 
Ik denk dat er voldoende consensus is over status.
 
Bvd Ben
Titel: Re: rietgans, again...
Bericht door: Martijn Bot op december 02, 2010, 09:41:09 am
Los van de determinatie-problematiek en de vragen omtrent de status van Taigarietgans in de grote winst van deze discussie dat iedereen vanaf nu in ieder geval serieuzer omgaat met de soort/soorten en wellicht ook meer moeite gaan doen om gevallen te documenteren. Dat gaat vast een schat aan informatie/discussie opleveren die ons de winter wel door zal helpen en wellicht vanzelf tot antwoorden op sommige van de in dit topic gestelde vragen zal leiden.
Ik heb in ieder geval wel weer zin gekregen om wat winterdagjes te steken in Rietganzen. Roodhalsganzen herken ik inmiddels wel...
Titel: Re: rietgans, again...
Bericht door: hiskodevries op december 02, 2010, 09:47:37 am
Kan Hisko of iemand anders er voor zorgen dat taiga's op de voorpagina belanden als rode of donkerrode soort?
 
Ik denk dat er voldoende consensus is over status.
 
Bvd Ben
Ben, binnen de vogeladmin groep nog niet, en oh ik doe zo mijn best, al was het maar voor een jaartje om mensen bewust te maken en zo echt inzicht te krijgen in de verspreiding.
Die tabel die hier onder handen is laat ik meelopen http://tiny.cc/5m1uj  zodat daarnaar verwezen kan worden bij 'strijd'
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 02, 2010, 09:48:18 am
http://waarneming.nl/waarneming/view/51132677 (http://waarneming.nl/waarneming/view/51132677)

Inderdaad in ieder geval hele spannende snavels!
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Ben Gaxiola op december 02, 2010, 12:12:25 pm
Kan Hisko of iemand anders er voor zorgen dat taiga's op de voorpagina belanden als rode of donkerrode soort?
 
Ik denk dat er voldoende consensus is over status.
 
Bvd Ben
Ben, binnen de vogeladmin groep nog niet, en oh ik doe zo mijn best, al was het maar voor een jaartje om mensen bewust te maken en zo echt inzicht te krijgen in de verspreiding.
Die tabel die hier onder handen is laat ik meelopen http://tiny.cc/5m1uj (http://tiny.cc/5m1uj)  zodat daarnaar verwezen kan worden bij 'strijd'

Hoi Hisko,
 
Bedankt voor je reactie, maar het lijkt me toch voor iedereen duidelijk dat een taigarietgans veel zeldzamer is dan oa kraanvogel, rosse franjepoot, bladkoning en pestvogel? Het lijkt me daarom niet bezwaarlijk om de status op zijn minst te "upgraden" naar lichtrood....
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 02, 2010, 12:16:53 pm
http://waarneming.nl/waarneming/view/51143559 (http://waarneming.nl/waarneming/view/51143559)
 
Ze zitten er nog (38). Zou leuk zijn als het klopt, zijn we meteen van dat CDNA verhaal af en hoeven we niet naar TOH..
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: peterlindenburg op december 02, 2010, 12:30:10 pm
Ik heb geen 17 pagina's materie gelezen, maar 1 ding is mij duidelijk geworden: ik heb geen zekere taigarietgans in NL... -1, mijn twee waarnemingen heb ik op onzeker gezet. Ik hoop dat waarnemingen op het hoofdscherm verschijnen




groet Peter
Titel: Re: rietgans, again...
Bericht door: migratorius op december 02, 2010, 13:23:51 pm
Die groep van Luissel is toch wel vaker gezien (ik meen zelfs gepiept door Enno Ebels een paar jaar terug?)
Dat was voordat ik Taigarietgans van m'n lijst gooide natuurlijk...

Jan Hein
Titel: Re: rietgans, again...
Bericht door: Ben Gaxiola op december 02, 2010, 14:28:58 pm
Kan Hisko of iemand anders er voor zorgen dat taiga's op de voorpagina belanden als rode of donkerrode soort?
 
Ik denk dat er voldoende consensus is over status.
 
Bvd Ben
Ben, binnen de vogeladmin groep nog niet, en oh ik doe zo mijn best, al was het maar voor een jaartje om mensen bewust te maken en zo echt inzicht te krijgen in de verspreiding.
Die tabel die hier onder handen is laat ik meelopen http://tiny.cc/5m1uj (http://tiny.cc/5m1uj)  zodat daarnaar verwezen kan worden bij 'strijd'

Hoi Hisko,
 
Bedankt voor je reactie, maar het lijkt me toch voor iedereen duidelijk dat een taigarietgans veel zeldzamer is dan oa kraanvogel, rosse franjepoot, bladkoning en pestvogel? Het lijkt me daarom niet bezwaarlijk om de status op zijn minst te "upgraden" naar lichtrood....

Hisko,
 
Ik zag dat Taigarietgans nu op het hoofdscherm verschijnt. Dank hiervoor!
 
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 02, 2010, 16:13:15 pm
http://waarneming.nl/waarneming/view/51132677 (http://waarneming.nl/waarneming/view/51132677)
 
Ik weet al waar ik zaterdag heen ga...

Jij ook al? Komt Sinterklaas in Boxtel aan  ;D ?

Ik zie net dat Max een deel van de vogels heeft en ook hoort. Wat is dat andere geluid Max? Ik ben benieuwd. Het is interessant dat de vogels zich bevinden in het Helvoirtse Broek, waar in de jaren tachtig ook in zachte winters nog taiga's zijn geringd.

Overigens krijg ik het artikel van Huyskens per kopie van Arjan Boele, waarvoor ik hem nu al zeeer erkentelijk ben! Ik zal jullie tzt. de hoofdlijnen van deze 150 kantjes meedelen.
Titel: Re: rietgans, again...
Bericht door: henkjanvdkolk op december 02, 2010, 21:32:38 pm
Op Xeno-Canto.org staan een aantal opnames van zowel toendra als taigarietgans (opgenomen in Zweden):
http://www.xeno-canto.org/XCspeciesprofiles.php?species_nr2=247.10&pagenumber=&order=taxonomy&view=3 (http://www.xeno-canto.org/XCspeciesprofiles.php?species_nr2=247.10&pagenumber=&order=taxonomy&view=3)
 
Goed te horen op sommige opnames is de 'Grauwe Gans-achtige' klank, maar er zit ook weer behoorlijk wat variatie in geluiden, in zowel toendra als taigas.
 
Op waarneming.nl staan alleen opnames van toendrarietgans:
http://waarneming.nl/soort/sounds/341 (http://waarneming.nl/soort/sounds/341)
 
Titel: Re: rietgans, again...
Bericht door: Marnix op december 02, 2010, 22:22:55 pm
Ik heb ook al even sonogrammen gemaakt van Taiga opnamen die op Xeno-Canto.org  (http://www.xeno-canto.org/europe/XCspeciesprofiles.php?species_nr2=247.10)staan en deze vergeleken met eigen opnamen van Toendrarietgans.
Zo op het eerst oog lijkt het dat Taigariet 2 duidelijke, zware banden rond de 2 kHz lijkt te hebben met een paar lichtere 'harmonics'(*) hier boven.
Toendrarietgans lijkt meer een evenredige verdeling te hebben van het aantal bandjes in de roep, zonder dat duidelijk aan te geven is wat de fundamentele roep is en wat de harmonics. Maar ik moet hier verder induiken om te zien of dit reël is of alleen te maken heeft met de afstand tot de opgenomen vogels.
 
(*) harmonics zijn bij bandjes op sonogram die vaak hoger liggen als de fundamentele roep en geven het geluid extra klankkleur.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 03, 2010, 13:25:16 pm
Allen,
 
De groep van Boxtel http://waarneming.nl/waarneming/view/51154029 (http://waarneming.nl/waarneming/view/51154029) zat er vandaag nog. Dick belde me en heeft opnamen gemaakt ook hij vond het geluid anders (zwaarder). Ik kan het moeilijk omschrijven hoe anders, mogelijk meer "hol" en zwaarder.
 
Succes morgen en betere platen zijn welkom. Toen ik er was lagen de vogels op de grond en bliezen nek en kopveren op vanwege de kou.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 03, 2010, 14:46:57 pm
Allen, De groep van Boxtel http://waarneming.nl/waarneming/view/51154029 (http://waarneming.nl/waarneming/view/51154029) zat er vandaag nog. Dick belde me en heeft opnamen gemaakt ook hij vond het geluid anders (zwaarder). Ik kan het moeilijk omschrijven hoe anders, mogelijk meer "hol" en zwaarder. Succes morgen en betere platen zijn welkom. Toen ik er was lagen de vogels op de grond en bliezen nek en kopveren op vanwege de kou. Groet Max

Mooi!
 
Een groep biedt uitstekende mogelijkheden om naar de onderlinge verhoudingen te kijken. Wie is man / vrouw, wie is met wie gepaard, zijn er families met jongen, etc. Kun je inderdaad alle individuen van deze groep met zekerheid identificeren als Taigarietgans? Wie wel? En wie niet? En waarom?
 
En een mooie uitdaging voor alle fotografen om een flink stel fantastische platen te schieten die bovenstaande variatie goed in beeld brengt.
 
Een goede analyse van goede sonogrammen (zie eerdere bericht van Marnix) is een uitgelezen mogelijkheid om grip te krijgen op de -mogelijke- verschillen in geluid. Want op die manier moet je uitkomen op een meetbaar iets (pieken en dalen etc) en kun je kijken of er consistente verschillen zijn tussen Toendrarietgans / Taigarietgans.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 03, 2010, 15:15:14 pm
Klaas en anderen,
 
Ik denk dat ID van de groep van Boxtel niet zo'n probleem is. Ik denk echter zelf dat de Boxtel vogels de makkelijke Taiga's zijn afkomstig van een bepaalde broedpopulatie (Scandinavie?, Rusland?). Het probleem blijft nog steeds bij Taiga's van andere populaties en welke van die populaties laat je onder Taiga en welke onder Toendra vallen. Wij, gevoed door gidsen geschreven in NW europe,  en mensen als Heinicke houden ons bezig met de bepaling wat een "standaard Taiga" is en maken het probleem te simpel of te complex (hoe je het wil lezen). Volgens mij gaan we naar een situatie dat er per geografisch gebied herkenbare vormen van Rietganzen zijn maar welke we Taiga's noemen (ja die van Boxtel wel) en welke Toendra's gaat nog een hele klus worden. Kijk ook maar eens naar de vele verschillen in de foto's van Toendra Rietganzen (bijv grote bekken en kleine delicate snavels) Gelijk aan de complexiteit van Kleine en Grote Canadeze gans vormen (zie Anderson)
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: lupokatja op december 03, 2010, 16:53:55 pm
Had helaas de afgelopen week te weinig tijd om de discussie te volgen laat staan er aan mee te doen. De tijd die er is besteed ik dan toch liever buiten en dat bleek in dit geval een goede keus. Overigens heb ik de vogels niet zelf ontdekt, maar ben ik gaan zoeken naar aanleiding van de waarneming van Bas van de Meulengraaf:
http://waarneming.nl/waarneming/view/51095769 (http://waarneming.nl/waarneming/view/51095769)


Ben het overigens absoluut eens met de opmerkingen van Max, die vergelijking met Grote Canadese Gans lijkt me terecht en zelfs deze heel uitgesproken vogels zie ik toch nog wel (vrijwel) elk jaar. Met uitzondering van vorig jaar (toen ze even bij Vlijmen zaten) en in 2008/2009 (helemaal niet gezien geloof ik) zitten ze bijna altijd op deze zelfde plek en zelfs op hetzelfde weiland bij Luissel/Esch, dus ik denk dat we kunnen spreken van een (restant van) historisch voorkomen. Weet overigens niet wat de plannen met het gebied zijn, heb zelf de indruk dat het toch langzaam volgroeit met boomkwekerijen etc...

Ben ook benieuwd of we het erover eens kunnen worden hoeveel het er nu uiteindelijk zijn. Mijn laatste telling van 38 was het aantal vogels dat geisoleerd net achter de boerderij in de sneeuw lag en waar ik maar geen heel erg afwijkende vogels tussen kon vinden. Weliswaar lag een groot deel te pitten, maar ik denk toch dat de schattingen van vandaag wat aan de lage kant zijn. Had zelf eerder ook minstens één (uitgesproken) familie tussen de Toendra’s en wat goede kandidaten tussen de Grote Canadeze Ganzen, dus ik denk niet dat je er automatisch vanuit moet gaan dat alle Taiga’s in één groep zitten. Wel is het zo dat de grote bulk duidelijk bij elkaar blijft.
Misschien ook nuttig om de kenmerken uit mijn lijstje en/of het aangepaste lijstje van Theo er eens naast te leggen.

Na het weekend heb ik als het goed is een paar avonden iets meer tijd, en hoop dan nog wat aan deze nuttige discussie bij te kunnen dragen.

Groeten,
Lützen

Voorzetje:
http://www.birdforum.tv/action/viewvideo/443/Tundra_Bean_Goose/
http://www.birdforum.tv/action/viewvideo/440/Taiga_Bean_Goose/
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op december 03, 2010, 22:52:31 pm
Als ook uit het geluid blijkt dat de vogels uit Brabant echte taiga's zijn dan is er nog hoop!
Ik vind deze vogels namelijk niet zo typisch als de vogels van Groningen afgelopen winter. Ik vind de koppen in vergelijking namelijk een stuk ronder en ook lijkt de snavel korter dan die van Groningen.
Dit soort vogels als die uit Brabant heb ik de afgelopen 2 jaar ook eind januari/februari wel gezien rondom het fochteloërveen. Soms in kleine groepjes aan de rand van groepen toendra's, maar ook wel eens 1 of 2 individuen gemengd in een groep toendra's. Ze vielen verder altijd direct op aan het grotere formaat!
Titel: Re: rietgans, again...
Bericht door: frankneijts op december 04, 2010, 00:00:09 am
Als ook uit het geluid blijkt dat de vogels uit Brabant echte taiga's zijn dan is er nog hoop!
Ik vind deze vogels namelijk niet zo typisch als de vogels van Groningen afgelopen winter. Ik vind de koppen in vergelijking namelijk een stuk ronder en ook lijkt de snavel korter dan die van Groningen.
Dit soort vogels als die uit Brabant heb ik de afgelopen 2 jaar ook eind januari/februari wel gezien rondom het fochteloërveen. Soms in kleine groepjes aan de rand van groepen toendra's, maar ook wel eens 1 of 2 individuen gemengd in een groep toendra's. Ze vielen verder altijd direct op aan het grotere formaat!

Heb je daarvan foto's Folkert-Jan? Zonder foto's die ook nog eens een keer vogels in nagenoeg dezelfde positie/houding/waarnemingshoek moeten weergeven zijn zulke vergelijkingen en zeker conclusies m.b.t. kopvorm/snavelvorm, halslengte etc. eigenlijk waardeloos. Als je al ziet (bijv. discussie DB-site!) hoe verschillend de interpretaties van 1 en dezelfde foto zijn!
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 04, 2010, 12:05:32 pm
Ik had die opmerking van Folkert Jan (of een ander) al verwacht.
 
De vogels van Boxtel zijn tot nu toe alleen gezien en gefotografeerd wanneer ze door het koude weer op de grond liggen en alle (kop en nek) veren opzetten. Dat er vogels bestaan met nog plattere en langere snavels geloof ik overigens niet.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: jvdlaan op december 04, 2010, 12:26:30 pm
Tabel wat aangepast.

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansMan groot, vrouw iets groter dan kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank over de hele lengteKorter, vrij dik, lang bij waken maar dan 'taps' met smaller middendeel
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank en puntig. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels geheel oranjegeel; minder dan de helft met zwartVoor meer dan de helft zwart, oranje overheersend in max 20%
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht
GeluidZwaar en laag, als grauwe, vaak 2-lettergrepigduidelijk hoger, vaak 3-lettergrepig
witte veertjes rond snavelZeer regelmatigMeestal niet
Borstopvallende zwanebult door ingehouden hals als zwaan kan opvallenniet zo

1) Ik kan het kenmerk 'zonder uitbuiging' niet plaatsen. Deze juveniele vogel - vooropgesteld dat juv vogels uit Finland Taiga's zijn - uit Finland heeft toch een duidelijke buiging in de snavel:
http://www.tarsiger.com/images/SL/peteruppstu_ansfab4.jpg

2) Verder kon ik op het internet en met name op de Finse sites die ik heb uit gepluisd nauwelijks een vogel vinden met witte veertjes om de snavel.

3) opvallende zwanebult door ingehouden hals als zwaan kan opvallen, beetje cryptische zin, ik snap niet helemaal wat er wordt bedoeld.
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op december 04, 2010, 14:02:04 pm
Nou lijken me dit ook niet de drie beste kenmerken. Witte veertjes rond de snavel zie ik zo vaak bij toendra's dat het kenmerk me niet bruikbaar lijkt. Die zwanenbult lijkt me een kwestie van houding en daarmee ook geen handig kenmerk.
Titel: Re: rietgans, again...
Bericht door: theomuusse op december 04, 2010, 15:22:35 pm
Tabel wat aangepast.

fabalisrossicus
LichaamsgrootteGroot, benadert Grauwe GansMan groot, vrouw iets groter dan kolgans
LichaamsvormLangwerpigGedrongen, compact (rond)
HalsLang, slank over de hele lengteKorter, vrij dik, lang bij waken maar dan 'taps' met smaller middendeel
Snavel-kopprofielKop enigzins afgeplat, doorlopend in snavel (Eider-profiel).Ronde kop, snavel lijkt vastgeplakt aan kop
SnavelLang, relatief slank en puntig. Nagel vaak iets uitstekend en gebogen(haakje).Vrij kort, dik (hoge basis)
OndersnavelDun en recht, geen uitbuigingDik, uitgebogen
NagelRondOvaal, taps toelopend
SnavelkleurMerendeels geheel oranjegeel; minder dan de helft met zwartVoor meer dan de helft zwart, oranje overheersend in max 20%
PootlengteRelatief langKort
LichaamskleurVrij licht, nauwelijks contrast tussen kop en lichaamOpvallend donkere kop
GroepsstructuurVrij losDicht
GeluidZwaar en laag, als grauwe, vaak 2-lettergrepigduidelijk hoger, vaak 3-lettergrepig
witte veertjes rond snavelZeer regelmatigMeestal niet
Borstopvallende zwanebult door ingehouden hals als zwaan kan opvallenniet zo

1) Ik kan het kenmerk 'zonder uitbuiging' niet plaatsen. Deze juveniele vogel - vooropgesteld dat juv vogels uit Finland Taiga's zijn - uit Finland heeft toch een duidelijke buiging in de snavel:
http://www.tarsiger.com/images/SL/peteruppstu_ansfab4.jpg (http://www.tarsiger.com/images/SL/peteruppstu_ansfab4.jpg)

2) Verder kon ik op het internet en met name op de Finse sites die ik heb uit gepluisd nauwelijks een vogel vinden met witte veertjes om de snavel.

3) opvallende zwanebult door ingehouden hals als zwaan kan opvallen, beetje cryptische zin, ik snap niet helemaal wat er wordt bedoeld.

We bedoelen dat de ondersnavel recht is zonder een hele flauwe kromming.
Van de 45 vogels van vandaag hadden 7 vogels een randje witte veertjes boven de snavel (AdJ).
Ik bedoel hiermee de bult die voorop de hals/ buik zit en die wordt veroorzaakt door een ingetrokken hals. Is soms opvallend

Theo
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 04, 2010, 16:10:42 pm
Observatie taigarietganzen                                                                                                                      4-12-2010           
 
Waarnemer: Albert de Jong
Medewaarnemers: PieterGeert Gelderblom en Henk-Jan van der Kolk
 
Locatie
Nabij Luissel (NB) in de graslanden tussen de Uilenbroek, de Schouwbeemdseweg en het riviertje De Esch. GPS: 51.598,5.265

Gedrag
Tussen 9.45 en 12.30 uur foeragerend met enkele  tientallen canadese ganzen, een familie kolganzen (2 adult, 1 juv), een adulte kleine rietgans en een groepje van 6 toendrarietganzen dat halverwege deze periode neerstrek aan de rand van de groep. Eén veld verder zat een los groepje van vier taiga’s dat later overstak naar de groep van 41 vogels. De vogels of  kleine groepjes foerageerden vrij los van elkaar, met soms enkele meters afstand. De meeste tijd lagen de vogels al grashappend om vervolgens een klein  stukje te lopen, te gaan liggen en verder te eten. Halverwege de ochtend gingen de vogels gemiddeld meer lopen en lopend foerageren.
Rond 12.30 vlogen de vogels op om 5 a 10 minuten te  drinken in De Esch. Daarna verplaatsten ze zich iets westelijker naar een  grasland met daarop circa 150 toendrarietganzen. Ze hielden zich duidelijk aan de zijlijn van deze groep op. Bij benadering met de auto reageerden ze alert door te ‘zekeren’.

Groepsidentiteit
De groep bestond uit 45 individuen, waarvan 38 met zekerheid volwassen en 3 eerste winters (4 onbepaald). Het verschil tussen adult en 1e winter bleek op afstand lastig te bepalen. Uiteindelijk werd duidelijk dat – op basis van de  ronde dekveren en de wollig getekende flank – er drie jonge vogels in de groep zaten. Door de groep ‘scopend’, viel op dat het gros van de vogels erg plat- en geelbekkig was, een goede indicatie dus. In directe vergelijking met toendrarietgans, viel de gemiddelde grootte op en was met het blote oog in te schatten waar toendra’s en waar taiga’s liepen. Door de losse groepsstructuur en de voornamelijk adulte vogels was het niet mogelijk om alle familieverbanden te zien. In sommige gevallen werd wel duidelijk dat twee vogels gezamenlijk optrokken en dat het mannetje de grootste van de twee was.
 
Kenmerken
 
Snavelvorm
Alle vogels hadden een typische ‘eendensnavel’ met een  lage basis van de bovensnavel en een platte ondersnavel zonder (op 150 meter) zichtbaar uitgebogen deel. De lengte van de snavel was in verhouding tot de aanwezige toendrarietganzen niet opvallend langer. Variatie tussen man en vrouw  qua snavellengte werd in enkele paartjes gezien. Bij sommige type A en B snavels werd de ronde nagel waargenomen (telescoop op 60x). Dit werd vergemakkelijkt doordat alleen de nagel zwart was en rest van de voorsnavel geel.
 
Snavelkleur
Van alle vogels werd de leeftijd bepaald, het type snavel volgens de figuur uit Burgers (1991) geturfd en gekeken of er witte kolletjes te zien waren. De uitslag van de geturfde snavels heeft Pieter Geert Gelderblom genoteerd en de verdeling kwam aardig overeen met de tabel uit Burgers 1991. Van de type A en B snavels hadden vrijwel alle vogels goed zichtbare neusgaten, waarschijnlijk veroorzaakt door zwart rond het neusgat.
De verdeling van 41 vogels was als volgt:
Type A: 6
Type B: 27
Type C: 7
Type D: 1

                               
Wit kolletje?
Zeker zeven volwassen vogels bleken aan de basis van de bovensnavel een fijn wit streepje te hebben, wat alleen in vooraanzicht te zien was. Later leken meer vogels dat te hebben. Het is dus lastig zichtbaar, maar  zeker 15% heeft dus een streepje witte bevedering boven de snavel. Bij één volwassen vogel met een type C snavel liep de witte bevedering langs de zijkant van de snave (http://www.pbase.com/albertdejong/image/130871856)l.

Lichaam / vleugel

In zit en rust is de kop met opgezette veren nog redelijk  hoekig. Eenmaal aler, lijkt deze kleiner en ronder dan toendrarietgans. Wanneer liggend leken de halzen vanwege de opgezette veren niet slank. Eenmaal  foeragerend werd bij veel vogels de uitstulpende borst en de typische kronkel in de hals zichtbaar. Qua profiel leken de ganzen wel wat op de aanwezige  canadese ganzen. De grootte was in directe vergelijking tot kolgans, toendrarietgans en kleine rietgans beduidend meer. Ongeveer 1,5x kolgans. Al  lopend viel de slome, wat onbeholpen gang op. De vooruitstekende borst zorgt voor een lang uitziend lichaam. De vleugelpunten van diverse taiga’s staken voorbij de staart (!). We vonden het lastig om iets over de lengte van de vleugel tijdens het vleugelflapperen te zeggen. De taiga’s hadden -vanwege actieve lichaamsrui, zo denk ik?- soms een zeer lichte buik. Maar erg bruikbaar lijkt me dat verder niet. Eén vogel had een stuk ijs aan de borst (http://www.pbase.com/albertdejong/image/130871771) hangen. Pootlengte leek een onbruikbaar kenmerk in het veld.

In vlucht
Op niet te grote afstand is in vlucht de variatie  man/vrouw zichtbaar. De gestrekte hals met een recht gedeelte is dan ook te  zien en indicatief. Alleen in een hoek van 90* is dit een bruikbaar kenmerk.  Eénmaal had ik ze wat dichterbij en in die hoek langsvliegend. De andere keren was de halslengte te moeilijk om in te schatten. De meevliegende kleine riet (http://www.pbase.com/albertdejong/image/130872832) leek beduidend kleiner en viel op door de grijze bovenvleugels!
 
Geluid
Om 12.30 vloog de groep om te gaan drinken. Daarvoor zaten ze volledig zwijgzaam aan de grond. In vlucht was de ‘fagotachtige’, zware en inderdaad tweelettergrepige roep te horen. Een meevliegende toendra pikten we er op geluid uit: meer snaterend en hoger. Met wat oefening en goede oren is dit denk ik goed bruikbaar!


Onbewerkte filmpjes op Youtube:

Met wat gemompel van me.

http://www.youtube.com/watch?v=Q1mGWaLfOcY (http://www.youtube.com/watch?v=Q1mGWaLfOcY)

http://www.youtube.com/watch?v=lzOJseSgRR0 (http://www.youtube.com/watch?v=lzOJseSgRR0)
http://www.youtube.com/watch?v=Hpc3OIIOZ2I (http://www.youtube.com/watch?v=Hpc3OIIOZ2I)
http://www.youtube.com/watch?v=FHb1_XgG2NU (http://www.youtube.com/watch?v=FHb1_XgG2NU)
http://www.youtube.com/watch?v=Q3v_62N2eqU (http://www.youtube.com/watch?v=Q3v_62N2eqU)
Titel: Re: rietgans, again...
Bericht door: jvdlaan op december 04, 2010, 16:36:37 pm
@Theo,
Wil je zeggen dat deze vogel http://www.tarsiger.com/images/SL/peteruppstu_ansfab4.jpg vanwege de kromming geen Taigarietgans is?

Ik snap nog steeds niet wat er nu bedoeld wordt met die zwanenbult. Wellicht de zin herformuleren, vooral deze nu ook wordt gebruikt in de determinatietabel.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 04, 2010, 16:41:42 pm
Jan, de buiging in de ondersnavel op de foto die je linkt, is naar binnen toe (dus een kromming naar boven) in plaats van naar beneden. Dat is juíst goed voor taiga! In toendra's is de ondersnavel naar buiten, dus naar beneden gebogen, wat voor een grotere grijnsplek zorgt.

Verder is zwanenbult misschien een rare omschrijving, maar prima te zien in het veld. Ik weet zo snel geen betere naam voor het idee dat de ingetrokken hals ervoor zorgt dat er een vooruitstekende bult ontstaat die duidelijk van de borstpartij te onderscheiden is. Ik zal wat plaatjes posten van vanmorgen die dat duidelijk maken.
Titel: Re: rietgans, again...
Bericht door: Marnix op december 04, 2010, 18:19:08 pm
Pontische Meeuwen kunnen zo'n zelfde S-buiging in hun hals hebben (de "zwanenbult") als ze in elkaar gedoken zitten.
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op december 04, 2010, 19:46:53 pm
De snavelvorm van de gans van Jan (dag Jan)  laat niet te wensen over voor een Taiga; lang en vlak voor de punt zelfs gebogen. Het kenmerk van de buiging betreft echter dat voorste gedeelte niet, maar de sterke welving aan de onderzijde van de onderste snavelhelft aan de basis čn de opening die zodoende ontstaat tussen bovenste en onderste snavelhelft. Niet alzo toe te passen dat een Taiga die opening in het geheel niet heeft, maar wel  veel minder.
Titel: Re: rietgans, again...
Bericht door: henkjanvdkolk op december 04, 2010, 20:34:29 pm
Hierbij een vergelijking van de snavelkleur van de vogels, ingedeeld volgens Burgers et al, 1991. Links in de bijlage de door Burgers gevonden percentages. Rechts de percentages van de 41 taigas die we volgens dezelfde indeling hebben ingedeeld.
Leuke overeenkomst!
Titel: Re: rietgans, again...
Bericht door: jvdlaan op december 04, 2010, 21:17:32 pm
De snavelvorm van de gans van Jan (dag Jan)  laat niet te wensen over voor een Taiga; lang en vlak voor de punt zelfs gebogen. Het kenmerk van de buiging betreft echter dat voorste gedeelte niet, maar de sterke welving aan de onderzijde van de onderste snavelhelft aan de basis čn de opening die zodoende ontstaat tussen bovenste en onderste snavelhelft. Niet alzo toe te passen dat een Taiga die opening in het geheel niet heeft, maar wel  veel minder.
(Ha Gerd) ik begin het zowaar te snappen. Volgende week (pas) ga ik naar de vogels bij Luissel, deze nieuw opgedane kennis in praktijk brengen.
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 05, 2010, 17:47:08 pm
Hallo,

Misschien is het leuk om via een DB Actueeltje op de DB website aandacht aan deze groep te schenken? Bijvoorbeeld even onderstrepen dat ID niet zo makkelijk is als altijd gedacht werd (refererend naar de lezing en samenvattend waar je op moet letten) en dat Taiga echt wel een schaarse rakker is en dat dit een goede kans is om ze te zien. Als een of enkelen van jullie dit op willen pakken dan zet ik het graag op de website!

Ben
Titel: Re: rietgans, again...
Bericht door: Martijn Bot op december 05, 2010, 18:01:18 pm
Verder is zwanenbult misschien een rare omschrijving, maar prima te zien in het veld. Ik weet zo snel geen betere naam voor het idee dat de ingetrokken hals ervoor zorgt dat er een vooruitstekende bult ontstaat die duidelijk van de borstpartij te onderscheiden is. Ik zal wat plaatjes posten van vanmorgen die dat duidelijk maken.
Zoiets?:
 
Titel: Re: rietgans, again...
Bericht door: Gert Veurink op december 05, 2010, 18:15:05 pm
Observatie taigarietganzen                                                                                                                      4-12-2010           
 
Waarnemer: Albert de Jong
Medewaarnemers: PieterGeert Gelderblom en Henk-Jan van der Kolk (...)

omdat nog niemand het gezegd heeft: Mooie uitgebreide en leerzame bijdrage! Leuke discussie geworden. Blij dat ik gisteren ook ben wezen kijken.
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 05, 2010, 22:12:18 pm
Observatie Taigarietganzen  4-12-2010 Waarnemer: Albert de Jong Medewaarnemers: PieterGeert Gelderblom en Henk-Jan van der Kolk (...)
omdat nog niemand het gezegd heeft: Mooie uitgebreide en leerzame bijdrage! Leuke discussie geworden. Blij dat ik gisteren ook ben wezen kijken.

Albert, PieterGeert en Henk-Jan,
 
Prachtig om jullie gedetailleerde observaties op deze wijze hier aan iedereen mee te delen. Jullie gedegen werkwijze is de manier hoe het moet!
 
En meteen wordt duidelijk dat ganzen observeren vaak geen makkie is. Het weer werkt niet mee (veel liggende / inactieve ganzen, dus weinig te zien van onderlinge interacties etc.) en de vogels zitten ver weg. Drie zeer kundige vogelaars hebben een halve dag aan deze groep besteed, maar het laatste woord is er zeker nog niet over gezegd.
 
Mooi om te horen dat jullie goed uit de voeten konden met de snavelpatroonindeling van Burgers cs. Een idee om eens een dergelijke steekproef (maar dan veel groter) te nemen van groepen Toendrarietganzen? Hebben jullie geoefend met de onderlinge 'repeatability' van de indeling in snaveltype? Hoe was dat?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 06, 2010, 17:35:00 pm
Albert en PieterGeert hebben aangeboden een artikel voor de DB website te schrijven. Bedankt alvast!
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 06, 2010, 18:02:40 pm
Net eens even wat aan het snuffelen geweest in de digitale ringverslagen van de BTO. Er zijn diverse terugmeldingen van de Rietganzen die Groot-Brittannië overwinteren; ook van vogels die in Nederland zijn geringd!
 
De BTO maakt ieder jaar een uitgebreid ringverslag. Dit wordt gepubliceerd in het tijdschrift 'Ringing & Migration'. De recente nummers van dit prachtige tijdschrift staan gewoon online en informatie over terugmeldingen van Rietganzen staat in
 
(1) het ringverslag over 2005 http://blx1.bto.org/pdf/ringmigration/23_3/ringing-report_05.pdf (http://blx1.bto.org/pdf/ringmigration/23_3/ringing-report_05.pdf) (zie pagina 183).
 
(2) het ringverslag over 2006 http://blx1.bto.org/pdf/ringmigration/24_1/report_2006.pdf (http://blx1.bto.org/pdf/ringmigration/24_1/report_2006.pdf) (zie pagina 46).
 
(3) het ringverslag over 2008 http://blx1.bto.org/pdf/ringmigration/24_4/report08.pdf (http://blx1.bto.org/pdf/ringmigration/24_4/report08.pdf) (zie pagina 308).
 
Veel leesplezier.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 06, 2010, 20:08:57 pm
Ter info,
 
Voor mensen die nog willen gaan:
 
06.12.2010

 Boxtel, Luissel / Uilenbroek (NB)  Wetter: 2°C, wolkig, 1001 hPa, Ost, 2 Bft., 08:15-14:00 Uhr  Der Nikolaus muss über die Niederlanden gekommen sein, denn dort hat er bereits am 01.12. einen großen Sack voll  mit Waldsaatgänsen ausgeschüttet. Diese habe ich mir heute am frühen Morgen ab 08:15 Uhr angeguckt. Der Morgendunst   war noch gar nicht richtig verflogen, als die Waldsaatgänse zusammen mit einem großen Trupp Tundrasaatgänsen ca. 400 m vor  mir auf einer Wiese landeten. Sofort fiel auf, dass die Waldsaatgänse deutlich größer und langhalsiger als die Tundrasaatgans sind.  Sie haben ein dreieckiges eher keilförmiges Schnabel-Kopfprofil und einen kräftigen langen flachen Schnabel mit viel Orangeanteil.  Beim Abflug gegen 09:30 riefen sie mit tiefen, nasalen, fagottartigen Stimmen „gang-gang“ und „kajak“.  Während meiner mehr als 1-stündigen Beobachtung konnte ich neben den Bestimmungsmerkmalen auch ausführlich die unterschiedlichen  Schnabelmuster (nach Burgers et. al. 1991) unterscheiden.  Ohne ersichtlichen Grund flog der gesamte Trupp aus Tundra- und Waldsaatgänsen gegen 09:30 Uhr nach Nord ab, eine Nachsuche mit zwei  hinzugekommen Beobachtern blieb leider bis 14:00 Uhr erfolglos. Während der heutigen Beobachtung konnte ich folgende Arten notieren:  Kanadagans 200, Weißwangengans 1, Tundrasaatgans 60, Waldsaatgans 25, Blessgans 2, Graugans 2, Nilgans 2, Stockente, Mäusebussard 2,  Turmfalke 1, Feldsperling (viele). 
  Tschüs, Norbert     Groet Max
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 06, 2010, 23:02:05 pm
Observatie Taigarietganzen  4-12-2010 Waarnemer: Albert de Jong Medewaarnemers: PieterGeert Gelderblom en Henk-Jan van der Kolk (...)
omdat nog niemand het gezegd heeft: Mooie uitgebreide en leerzame bijdrage! Leuke discussie geworden. Blij dat ik gisteren ook ben wezen kijken.

Albert, PieterGeert en Henk-Jan,
 
Prachtig om jullie gedetailleerde observaties op deze wijze hier aan iedereen mee te delen. Jullie gedegen werkwijze is de manier hoe het moet!
 
En meteen wordt duidelijk dat ganzen observeren vaak geen makkie is. Het weer werkt niet mee (veel liggende / inactieve ganzen, dus weinig te zien van onderlinge interacties etc.) en de vogels zitten ver weg. Drie zeer kundige vogelaars hebben een halve dag aan deze groep besteed, maar het laatste woord is er zeker nog niet over gezegd.
 
Mooi om te horen dat jullie goed uit de voeten konden met de snavelpatroonindeling van Burgers cs. Een idee om eens een dergelijke steekproef (maar dan veel groter) te nemen van groepen Toendrarietganzen? Hebben jullie geoefend met de onderlinge 'repeatability' van de indeling in snaveltype? Hoe was dat?
 
Groetjes, Klaas

Alleen even over de repeatability dan maar. De rest lezen jullie vast nog op de DB-site. We hebben er niet expliciet mee geoefend. Henk-Jan en ik gingen de vogels één voor één af, wat al veel tijd kostte vanwege de hoeveelheid liggende vogels. PieterGeert notuleerde en keek af en toe mee. Tja, -6C* en een straffe zuidenwind op je kop. Ik herinner me dat we een paar keer tegelijk type A snavels herkenden. Die herken je door te checken of dat er helemaal geen zwart aan de basis van de snavel te zien is. Type B zijn het meest typsich: iets zwart aan de basis, iets zwart rond het neusgat. Het verschil tussen type C en D is het lastigste te zien in het veld. Je moet dan zien of het geel aan de onderkant van de bovensnavel nog richting het neusgat gaat of dat er alleen een bandje te zien is.
Voorbeeld A en B (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=4129&page=1).

Overigens valt het me op dat tot nu toe veel waarnemers hooguit 25(+) vogels hebben gezien. Dat terwijl we vanaf de noordrand, dus de bomenrij langs de Esch, een homogene groep van 45 hadden met daarbij in eerste instantie geen enkel groepje toendra's.
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op december 06, 2010, 23:17:03 pm
Over het laatste (alleen voor mezelf sprekend): Ik kwam gister bij een eerste telling tot ca. 40 vogels. Later nog eens alleen de (voor mij) overduidelijke taiga's geteld en toen tot een stuk of 20 gekomen. Ik had wat moeite met wat vogels die er in een aantal opzichten goed uitzagen, maar bijvoorbeeld een stuk hogere bovensnavelbasis hadden/leken te hebben, te plaatsen. Overigens bevonden ook tijdens de ca. 1,5 uur die ik er gisteren doorbracht, de vogels zich regelmatig uit het zicht aan de achterzijde van de (aflopende) akker, vogels lagen langdurig met de kop in de veren, etc.

Ik vermoed dan ook dat in elk geval gisteren hetzelfde aantal aanwezig was maar dat anderen (ik in elk geval) niet zulk monnikenwerk verricht hebben als jullie  :duim:
Titel: Re: rietgans, again...
Bericht door: Gerard Troost op december 07, 2010, 12:15:40 pm
via http://twitter.com/SOVONnieuws/status/12092930512658432

Presentatie workshop determinatie rietganzen online beschikbaar: http://bit.ly/fNkf7b
Titel: Re: rietgans, again...
Bericht door: hiskodevries op december 07, 2010, 12:21:07 pm
via http://twitter.com/SOVONnieuws/status/12092930512658432

Presentatie workshop determinatie rietganzen online beschikbaar: http://bit.ly/fNkf7b
mm, in die presentatie staan foto`s met als fotograaf 'www.waarneming.nl' deze persoon heeft geen enkele foto in het systeem staan. kortom ik zie wat copyright issues.
Titel: Re: rietgans, again...
Bericht door: Roel Schwartz op december 07, 2010, 12:38:53 pm
Wat vinden jullie van dit ex. :rolleye: http://waarneming.nl/waarneming/view/51205401
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op december 07, 2010, 16:17:45 pm
Wat vinden jullie van dit ex. :rolleye: http://waarneming.nl/waarneming/view/51205401 (http://waarneming.nl/waarneming/view/51205401)

Leuk, die zwanenbult  :duim:
 
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 07, 2010, 17:00:01 pm
Leuk, die zwanenbult  :duim:

Waarmee je hopelijk niet wilt suggereren dat dit een Taiga is?
Ik zou hier in elk geval niet zenuwachtig van worden.
 
De vogels van Luissel lijken trouwens echt vertrokken. Voor de vorstgrens uit naar het noorden?
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op december 07, 2010, 21:18:47 pm
Leuk, die zwanenbult  :duim:

Waarmee je hopelijk niet wilt suggereren dat dit een Taiga is?
Ik zou hier in elk geval niet zenuwachtig van worden.
 
De vogels van Luissel lijken trouwens echt vertrokken. Voor de vorstgrens uit naar het noorden?

Je hebt gelijk dat ik dit niet wil suggeren, maar dit kenmerk aan de kaak wil stellen.
Maakt die zwanenbult dit nu taiga of is dat kenmerk totaal niet bruikbaar
Titel: Re: rietgans, again...
Bericht door: JohanvantBosch op december 07, 2010, 21:35:20 pm
Leuk, die zwanenbult  :duim:

Waarmee je hopelijk niet wilt suggereren dat dit een Taiga is?
Ik zou hier in elk geval niet zenuwachtig van worden.
 
De vogels van Luissel lijken trouwens echt vertrokken. Voor de vorstgrens uit naar het noorden?

Je hebt gelijk dat ik dit niet wil suggeren, maar dit kenmerk aan de kaak wil stellen.
Maakt die zwanenbult dit nu taiga of is dat kenmerk totaal niet bruikbaar
Het gaat om de hele set aan kenmerken, hč. Niet eentje eruit pikken!  ;D
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 07, 2010, 22:39:51 pm
Wat vinden jullie van dit ex. :rolleye: http://waarneming.nl/waarneming/view/51205401 (http://waarneming.nl/waarneming/view/51205401)

Een valkuil waarmee deze discussie (en de vorige) ooit begonnen is en waar heel veel mensen nog steeds in trappen: op zoek naar verondersteld afwijkende vogels tussen de toendrarietganzen. Niet doen! Rietganzen moet je op groepsniveau bekijken en als je echt een taiga wil zien: heeft meer dan 50% van de groep een overwegend gele snavel, ga dan het volledige set kenmerken af en je zult zien dat er dan wat begint te dagen.
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 07, 2010, 23:08:37 pm
Waarom niet doen? Is het onmogelijk een Taiga tussen de Toendra's vandaan te halen en andersom? Is er te veel overlap daarvoor?
Titel: Re: rietgans, again...
Bericht door: theomuusse op december 07, 2010, 23:20:07 pm
Waarom niet doen? Is het onmogelijk een Taiga tussen de Toendra's vandaan te halen en andersom? Is er te veel overlap daarvoor?

Ja, als je maar naar 1 kenmerk kijkt.
Nee, met enkele kenmerken gecombineerd zeker te doen!

ps, ik zie bij de eerste vogel in deze discussie niet eens een zwanebult, laat staan de rest...

Theo
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 07, 2010, 23:28:44 pm
Is het onmogelijk een Taiga tussen de Toendra's vandaan te halen en andersom?

Ja, voor een onervaren waarnemer die niet van elk taxa jaarlijks minstens enkele honderden ziet eigenlijk wel. Daar hoort sinds de zeventiger jaren nagenoeg elke Nederlander bij, mij incluis. Je bent dan (1) onvoldoende op de hoogte van de variatie binnen de taxa en nog belangrijker (2), je lapt een belangrijk gegeven van TH (en met hem alle rietganzenexperts uit de gescheidenis) aan je laars. Namelijk dat taiga's zich bijna altijd aan de rand van een groep toendra's bewegen of andersom. Zoeken naar 'afwijkende' vogels in een groep toendrarietganzen is dus heel erg hachelijk. Vooral omdat je het idee 'groepsidentiteit' niet kunt gebruiken, wat juist zo bruikbaar is als wat. Vandaar dat het ook erg lastig is om iets over losse vogels als recentelijk deze in Frankrijk (http://www.ornitho.fr/index.php?m_id=54&id=6774) te zeggen , mits het om een heel erg uitgesproken vogel gaat die je heel goed ziet en het liefst ook nog eens hoort, goed fotografeert en beschrijft. Dat het wel kan, laat bijvoorbeeld de vogel van Voorhout van twee winters terug zien. Dat het erg lastig is, laten al die waarnemingen zien waarbij waarnemers de mist ingaan door één vogel op basis van bijvoorbeeld alleen de snavel aan te wijzen als taiga. Zie bijvoorbeeld blz. 9 van deze pdf (http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf). Ik heb het eens gedurfd bij deze vogel (http://waarneming.nl/waarneming/view/41386620). Voor mij gaf toen de combinatie gedrag, grootte, snavelvorm, lichaamsvorm en uiteindelijk het horen van de zware fagotroep de doorslag.
Titel: Re: rietgans, again...
Bericht door: Rutger op december 07, 2010, 23:48:35 pm
Ik kan me zo voorstellen dat een groepje taiga's overtuigender overkomt dan een enkel individu tussen de toendra's, maar dat neemt natuurlijk niet weg dat er een taiga tussen de toendra's kan zitten. Uiteindelijk zitten roodhalzen vaak ook als enkel individu tussen de brandjes of rotjes.

Wat ik me altijd wel afvraag (ook bij bijvoorbeeld witkopstaartmezen tussen de gewone staartmezen) is of de variatie binnen een soort het niet gewoon 'toelaat' dat er dusdanig extreme individuen in zo'n groep toendra's tussen zitten die nagenoeg gelijk zijn aan taiga's. Eigenlijk is het de herkomst van een vogel die bepaald of het een taiga- of toendrarietgans is. Die herkomst is te bepalen aan de hand van morfologische kenmerken die door lange tijd van isolatie van de 2 grote populaties (taiga en toendra) zijn ontstaan. Maar bij (onder)soorten die zo ontzettend dicht bij elkaar liggen, kan ik me voorstellen dat er af en toe een individu in een groep toendra's zit dat dusdanig veel kenmerken van een taiga heeft, dat hij als zodanig wordt herkend, terwijl hij het in werkelijkheid niet is.

Denk dat het hierom is dat zo'n groep veel gaver/overtuigender is dan een enkele vogel tussen de toendra's. De volgende groep ga ik maar eens een bezoekje geven denk ik... Gelukkig heb ik in ieder geval die van Voorhout 2008 gezien...
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op december 08, 2010, 07:41:10 am
Leuk, die zwanenbult  :duim:

Waarmee je hopelijk niet wilt suggereren dat dit een Taiga is?
Ik zou hier in elk geval niet zenuwachtig van worden.
 
De vogels van Luissel lijken trouwens echt vertrokken. Voor de vorstgrens uit naar het noorden?

Je hebt gelijk dat ik dit niet wil suggeren, maar dit kenmerk aan de kaak wil stellen.
Maakt die zwanenbult dit nu taiga of is dat kenmerk totaal niet bruikbaar
Het gaat om de hele set aan kenmerken, hč. Niet eentje eruit pikken!  ;D

jaja rustig maar, heb het topic ook gelezen, maar dan moet het wel een bruikbaar kenmerk zijn toch welke je significant vaker ziet bij taiga's.
Ik heb nooit op dit kenmerk gelet en vraag me af of deze vogel een uitzondering is.

Ook laat deze vogel mijns inzien wel meer trekjes van taiga zien en is het imo geen typische toendra
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 08, 2010, 08:50:20 am
Citaat
zeventiger jaren

Nou begin jaren negentig waren ze toch ook jaarlijks te vinden op plekken welke van oudsher bekend waren. Zie de plek bij Boxtel waar de vogels in ieder gevan in 2003,2005 en 2010 dus nog steeds gezien zijn.
 
Ik vind het overigens prachtig dat jonge waarnemers als Albert en Pieter Geert de zaak zo oppakken maar (deze) jonge waarnemers moeten zich realiseren dat wanneer je op het internet geen foto's kan vinden van Taiga's uit de oude doos de soort daarmee niet niet aanwezig is geweest (in bepaalde aantallen). Digitale fotografie en daarmee het populair worden van fotografie op de manier zoals we het nu kennen is immers pas een jaartje of 10 oud. Zoek maar eens naar foto's van Kuifleeuwerikken in de Duinstreek. In Katwijk zal je er wel wat vinden (maar dat was dan ook jaren lang het analoge fotografich hart van NL (R. van Rossum)) maar verder weinig. Toch waren ze toen ik begon met vogelen begin jaren tachtig toch echt niet zeldzaam..
 
Daarnaast is de Taiga discussie in de mate waarin we hem nu voeren minder dan vijf jaar oud. Daarvoor maalde slecht een enkeling er om (waarvan ik er latent sinds 1992 een was) en het werd pas echt een issue na de split in NL, dus werden er ook weinig vogels gefotografeerd.
 
Groet van een ouwe L.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 08, 2010, 09:36:35 am
Citaat
zeventiger jaren

Nou begin jaren negentig waren ze toch ook jaarlijks te vinden op plekken welke van oudsher bekend waren. Zie de plek bij Boxtel waar de vogels in ieder gevan in 2003,2005 en 2010 dus nog steeds gezien zijn.
 
Ik vind het overigens prachtig dat jonge waarnemers als Albert en Pieter Geert de zaak zo oppakken maar (deze) jonge waarnemers moeten zich realiseren dat wanneer je op het internet geen foto's kan vinden van Taiga's uit de oude doos de soort daarmee niet niet aanwezig is geweest (in bepaalde aantallen). Digitale fotografie en daarmee het populair worden van fotografie op de manier zoals we het nu kennen is immers pas een jaartje of 10 oud. Zoek maar eens naar foto's van Kuifleeuwerikken in de Duinstreek. In Katwijk zal je er wel wat vinden (maar dat was dan ook jaren lang het analoge fotografich hart van NL (R. van Rossum)) maar verder weinig. Toch waren ze toen ik begon met vogelen begin jaren tachtig toch echt niet zeldzaam..
 
Daarnaast is de Taiga discussie in de mate waarin we hem nu voeren minder dan vijf jaar oud. Daarvoor maalde slecht een enkeling er om (waarvan ik er latent sinds 1992 een was) en het werd pas echt een issue na de split in NL, dus werden er ook weinig vogels gefotografeerd.
 
Groet van een ouwe L.

Ha Max,
Ik baseerde dat 'jaren zeventig' vooral op het uitvoerige artikel van Huyskens (1986). Wat die aan rietganzen heeft gezien in Zuid-Zweden, de noordelijke DDR, Polen en de Benelux tussen 1960 en 1985(!) is ongekend. Hij houdt de verhouding fabalis en rossicus op moment van het schrijven van zijn artikel op 2.000 tegenover 100.000 in ons land (p.130). Hij heeft samen met zijn collega's vanaf het begin vrijwel hetzelfde set kenmerken als wij inmiddels in deze discussie hebben opgerakeld gebruikt, behalve geluid (p.139-140). Hij beschrijft dat de discussie zich vanaf de jaren zeventig wel degelijk heeft afgespeeld onder ganzenvangers en ganzenkijkers. Die onderscheidden in eerste instantie massaal kleine (brachyrhynchus) en grote rietgans (fabalis), waarbij ineens steeds vaker een mengvorm optradt (rossicus!). Leo van den Bergh heeft consequent beide taxa onderscheiden. Hij heeft het vooral over zwartbekken en geelbekken, een vreemde omschrijving gezien het feit dat Thomas Heinicke benadrukte dat zowel oostelijke als westelijke taigavogels zich keurig houden aan de snavelkleurverdeling van Burgers. Verder hebben we het al eens gehad over zijn artikelen.

Ik geloof best dat het op bepaalde plekken in de jaren '90 nog wel te doen was om taiga's te zien. Foto's daarvan vragen zou inderdaad niet zo reëel zijn. Dan zou ik inderdaad een jong schreeuwertje zijn. Ik vond het wel erg leuk dat Adri Hottinga me op de Sovondag een map met daarin oude, afgedrukte dia's van kleine groepjes taiga's in de winter van '79 liet zien. Ze zijn er dus wel.

En over de discussie, tja, dit is toch wel een van de grote zegeningen van waarneming.nl

Edit: inderdaad Trinus, Zuid-Zweden en noordelijk DDR. Slip of the tongue. 'Ze zijn er dus wel' sloeg op de dia's en niet zozeer op de vogels.
En Rutger gaf een mooie samenvatting tussendoor!
Titel: Re: rietgans, again...
Bericht door: Cygnus op december 08, 2010, 10:22:16 am
Ik baseerde dat 'jaren zeventig' vooral op het uitvoerige artikel van Huyskens (1986). Wat die aan rietganzen heeft gezien in de Baltische staten, Polen en de Benelux tussen 1960 en 1985(!) is ongekend. .......
 
.....Ik vond het wel erg leuk dat Adri Hottinga me op de Sovondag een map met daarin oude, afgedrukte dia's van kleine groepjes taiga's in de winter van '79 liet zien. Ze zijn er dus wel.

De Baltische staten zijn Estland, Letland en Litouwen. Daar is Huyskens nooit geweest. Je bedoeld waarschijnlijk Zuid-Zweden en het noorden van de voormalige DDR.
Misschien niet bij iedereen bekend, maar de winter van 78/79 was een erg extreme winter. Er zaten toen als gevolg van zeer extreem winterweer overal kleine groepjes ganzen waar ze anders nooit zaten, bijvoorbeeld Taigarietganzen in ZW-Friesland. Die winter is dus niet een erg representatieve winter m.b.t. het normale voorkomen van Taigarietganzen in Nederland in die tijd.   
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 08, 2010, 12:06:37 pm
Albert (en Pieter Geert)
 
Nogmaals hulde hoe "wetenschappelijk" jullie het aanpakken.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op december 08, 2010, 14:00:48 pm
Albert (en Pieter Geert)
 
Nogmaals hulde hoe "wetenschappelijk" jullie het aanpakken.
 
Groet Max


Vind ik ook; weinig schreeuwerigheid van hun kant. Veeleer jong enthousiasme waar goed naar geluisterd kan worden.
Titel: Re: rietgans, again...
Bericht door: arnoud.vandenberg op december 08, 2010, 17:32:47 pm
De stelling van Max, dat we minder dan vijf jaar kritisch naar Taigarietganzen kijken, kan ik niet onderschrijven. De meeste vogelaars gingen al 15 jaar geleden, direct na de taxonomische   beslissing van Sangster et al (Dutch Birding 18: 310-316, 1996), hun best doen om de twee te onderscheiden. Zelf begon ik in 2000 met een handvol anderen geluiden te verzamelen voor The Sound Approach en dat betekende dat we iedere winter probeerden de soort te vinden. Dat was tevergeefs: in die 10-11 jaren lukte het slechts twee keer om een enkele Taiga in een groep Toendrarietganzen te fotograferen; geluiden opnemen was nooit mogelijk. Er waren in die jaren nu en dan Taigameldingen maar, als er al foto's boven water kwamen, betrof het vrijwel altijd zekere Toendra's of onzekere rieten. Zelden kwamen er fotootjes die overtuigden, zoals een paar keer te Boxtel/Oisterwijk en in het noordoosten, maar dat waren dan steeds vogels die niet werden teruggevonden. De afgelopen week te Boxtel vond ik dan ook heel speciaal: een behoorlijk aantal Taiga's dat zich dagen achtereen liet bekijken. Wat de situatie in de jaren 1980 en daarvoor was, is lastig te achterhalen. Max heeft gelijk dat er toen nauwelijks werd gefotografeerd en dat vogelaars geen of onjuiste informatie hadden over de herkenning (de veldgidsen schoten ernstig tekort; dat doen ze in feite nog steeds). Op basis van de verhalen (artikelen van Voous etc) lijkt het inderdaad denkbaar dat Taiga's tot een kwart eeuw geleden veel talrijker waren dan nu, misschien een halve eeuw geleden zelfs wel talrijker dan Toendra's...
Titel: Re: rietgans, again...
Bericht door: Roel Schwartz op december 08, 2010, 17:32:55 pm
http://waarneming.nl/waarneming/view/46025752 (http://waarneming.nl/waarneming/view/46025752) :rolleye:  Dit is voorlopig de laatste heren, ik ben benieuwd wat jullie van dit ex. vinden?
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op december 08, 2010, 21:02:02 pm
@Arnoud: Heb je zondag nu wel bruikbare geluidsopnamen kunnen maken - tussen de langsrazende treinen door?
Titel: Re: rietgans, again...
Bericht door: Rutger op december 08, 2010, 22:07:52 pm
http://waarneming.nl/waarneming/view/46025752 (http://waarneming.nl/waarneming/view/46025752) :rolleye:  Dit is voorlopig de laatste heren, ik ben benieuwd wat jullie van dit ex. vinden?


Ik zou er op basis van deze enkele foto niet echt iets over durven te zeggen. De vorm van de snavel is bijvoorbeeld moeilijk te bepalen als je maar 1 foto hebt. Vogel is niet opvallend groot trouwens (als je hem vergelijkt met die kleine ernaast).
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 09, 2010, 06:26:26 am
http://waarneming.nl/waarneming/view/46025752 (http://waarneming.nl/waarneming/view/46025752) :rolleye:  Dit is voorlopig de laatste heren, ik ben benieuwd wat jullie van dit ex. vinden?

@ Roel: Allereerst nogmaals de kanttekening die Albert bovenaan deze pagina geeft. Zijn '50%-norm' lijkt misschien een versimpeling van de werkelijkheid, maar is volledig in lijn met bijvoorbeeld Huyskens (1977) en Heinicke (2005), en daarmee het beste in het veld bruikbare (!) kenmerk dat we op dit moment hebben! Je waarneming betreft drie vogels. Trokken ze als (familie)groepje op? Hadden ze alledrie zo'n ogenschijnlijk grote, gele snavel? Heb je wellicht nog meer kenmerken genoteerd dan op dit fotootje te zien zijn? Zonder duidelijkheid over deze vragen wordt het, zoals Rutger al aangeeft, namelijk lastig...
 
@ Theo M: Toen ik gistermiddag mijn helft van het DB-actueeltje schreef, viel me ineens een foutje op in je tabel. De tarsuslengte van Taigarietgans is namelijk juist relatief korter dan die van Toendrarietgans, zie bijvoorbeeld Roselaar (1977). Misschien even aanpassen, of heb jij een andere bron?
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op december 09, 2010, 08:34:42 am
http://waarneming.nl/waarneming/view/46025752 (http://waarneming.nl/waarneming/view/46025752) :rolleye:  Dit is voorlopig de laatste heren, ik ben benieuwd wat jullie van dit ex. vinden?

@ Roel: Allereerst nogmaals de kanttekening die Albert bovenaan deze pagina geeft. Zijn '50%-norm' lijkt misschien een versimpeling van de werkelijkheid, maar is volledig in lijn met bijvoorbeeld Huyskens (1977) en Heinicke (2005), en daarmee het beste in het veld bruikbare (!) kenmerk dat we op dit moment hebben! Je waarneming betreft drie vogels. Trokken ze als (familie)groepje op? Hadden ze alledrie zo'n ogenschijnlijk grote, gele snavel? Heb je wellicht nog meer kenmerken genoteerd dan op dit fotootje te zien zijn? Zonder duidelijkheid over deze vragen wordt het, zoals Rutger al aangeeft, namelijk lastig...
 
@ Theo M: Toen ik gistermiddag mijn helft van het DB-actueeltje schreef, viel me ineens een foutje op in je tabel. De tarsuslengte van Taigarietgans is namelijk juist relatief korter dan die van Toendrarietgans, zie bijvoorbeeld Roselaar (1977). Misschien even aanpassen, of heb jij een andere bron?
@ Jan-Pieter: zoals al eens eerder vermeld zijn veel maten en aannames in oude literatuur (zoals Roselaar 1977) gebaseerd op balgen, dus wintervogels. Er zijn geen vogels uit broedgebieden te vinden  in de musea in Leiden, Amsterdam en Tring (in deze heb ik recent rondgedwaald en rietganzen bekeken), waarvan nog maar aangetoond moet worden dat de betreffende labels kloppen. Dus ben voorzichtig met deze interpretatie.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 09, 2010, 11:50:29 am
Via http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf (http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf) is een rapport / boek van Emelyano (?) uit 2000 te downloaden met -naar het lijkt- allerlei informatie over Rietganzen. De titel is:
 
Емельянов В.И.
Е 598 Морфометрический анализ гуменника как основа охраны и рацио-нального использования гусей Приенисейской Сибири: Бюл. КРМЭОД «За сохранение природного наследия» / Краснояр. гос. ун-т. Красноярск, 2000. Вып. 1. 124 с.
   
Vanaf pagina 76 staan allerlei tabellen met maten van Rietganzen. Helaas is mijn kennis van het Russisch minimaal. Het eerste woord van de titel zou iets kunnen zijn als 'morfometrisch'.
 
Vriendelijke groeten,
 
Klaas van Dijk
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op december 09, 2010, 12:12:13 pm
Via http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf (http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf) is een rapport / boek van Emelyano (?) uit 2000 te downloaden met -naar het lijkt- allerlei informatie over Rietganzen. De titel is:
 
Емельянов В.И.
Е 598 Морфометрический анализ гуменника как основа охраны и рацио-нального использования гусей Приенисейской Сибири: Бюл. КРМЭОД «За сохранение природного наследия» / Краснояр. гос. ун-т. Красноярск, 2000. Вып. 1. 124 с.
 
Vanaf pagina 76 staan allerlei tabellen met maten van Rietganzen. Helaas is mijn kennis van het Russisch minimaal. Het eerste woord van de titel zou iets kunnen zijn als 'morfometrisch'.
 
Vriendelijke groeten,
 
Klaas van Dijk
Grove vertaling (Babelfish)                                         : Morphometric analysis of [gumennika] as the basis of protection and economical utilization of geese of Yenisey Siberia
Titel: Re: rietgans, again...
Bericht door: Cygnus op december 09, 2010, 12:31:54 pm
Via http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf (http://eco.institute.sfu-kras.ru/sites/eco.institute.sfu-kras.ru/files/Emelyanov3.pdf) is een rapport / boek van Emelyano (?) uit 2000 te downloaden met -naar het lijkt- allerlei informatie over Rietganzen. De titel is:
   
Емельянов В.И.
 
Е 598 Морфометрический анализ гуменника как основа охраны и рацио-нального использования гусей Приенисейской Сибири: Бюл. КРМЭОД «За сохранение природного наследия» / Краснояр. гос. ун-т. Красноярск, 2000. Вып. 1. 124 с.
 
Vanaf pagina 76 staan allerlei tabellen met maten van Rietganzen. Helaas is mijn kennis van het Russisch minimaal. Het eerste woord van de titel zou iets kunnen zijn als 'morfometrisch'.
 
Vriendelijke groeten,
 
Klaas van Dijk
[/l]

Hoi Klaas,
 
De officiële engelse titel van dit artikel is: 
Emelyanov, V.I., 2000. Morphometry Analyses of the Bean Goose (Anser fabalis Lath.) as a Basis of Protection and Rational Use of the Geese in Priyeniseiskaya Siberia. Krasnoyarsk State University, Krasnoyarsk (in Russian).
 
Het artikel bevat ook gegevens van diverse terugmeldingen van geringde ganzen. Het schijnt een belangrijk artikel te zijn m.b.t. het Rietgans-gebeuren in Centraal Siberië.
 
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 09, 2010, 13:08:41 pm
Hoi Klaas, de officiële engelse titel van dit artikel is: Emelyanov, V.I., 2000. Morphometry Analyses of the Bean Goose (Anser fabalis Lath.) as a Basis of Protection and Rational Use of the Geese in Priyeniseiskaya Siberia. Krasnoyarsk State University, Krasnoyarsk (in Russian). Het artikel bevat ook gegevens van diverse terugmeldingen van geringde ganzen. Het schijnt een belangrijk artikel te zijn m.b.t. het Rietgans-gebeuren in Centraal Siberië.

hoi Trinus,
 
Bedankt voor je toelichting. Inderdaad een tabel met terugmeldingen gevonden, ook van vogels die in Nederland zijn geringd. Het artikel nogmaals doorgescand en ik denk dat je best wel eens gelijk zou kunnen hebben dat er belangrijke informatie instaat over Rietganzen in Centraal Siberië. M.i. staat goed uitgelegd (ook met tekeningen!) hoe alle maten zijn genomen en er staan m.i. ook allerlei tabellen in met samenvattende gegevens (over maten etc.). Ook diverse tekeningen van koppen.
 
Met wat doorzettingsvermogen en het vertalen van enkele kernbegrippen kom je denk ik een heel eind met betrekking tot het begrijpen van de essentie van veel figuren en tabellen en dan moet je de lange bijlage met de basisgegevens ook wel kunnen lezen.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Roel Schwartz op december 09, 2010, 13:31:26 pm
@ Roel: Allereerst nogmaals de kanttekening die Albert bovenaan deze pagina geeft. Zijn '50%-norm' lijkt misschien een versimpeling van de werkelijkheid, maar is volledig in lijn met bijvoorbeeld Huyskens (1977) en Heinicke (2005), en daarmee het beste in het veld bruikbare (!) kenmerk dat we op dit moment hebben! Je waarneming betreft drie vogels. Trokken ze als (familie)groepje op? Hadden ze alledrie zo'n ogenschijnlijk grote, gele snavel? Heb je wellicht nog meer kenmerken genoteerd dan op dit fotootje te zien zijn? Zonder duidelijkheid over deze vragen wordt het, zoals Rutger al aangeeft, namelijk lastig...


Ha PieterGeert,


Het waren drie afzonderlijke individuen, wel beschikten alle drie de ex. over een grotendeels gele snavel. Helaas heb ik toen nog niet goed gelet op de tegenwoordig genoemde vlakke ondersnavel als determinatiekenmerk. Vooralsnog blijft het inderdaad moeilijke stuff en is inderdaad een zeer gedetailleerde beschrijving en mijn inziens nog belangrijker een goede foto van het snavelprofiel noodzakelijk om tot een goede determinatie te komen. Bij SOVON-ganzenkenners heb ik altijd wel geleerd dat de Taiga vaak de periferie van een groep ganzen opzoeken, maar of dit ook daadwerkelijk zo is weet ik niet. Misschien dat jouw daar meer over bekend is. Bedankt trouwens voor het meedenken en ook de anderen die ik vergeten ben.
 

Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 09, 2010, 16:59:22 pm
   
@ Jan-Pieter: zoals al eens eerder vermeld zijn veel maten en aannames in oude literatuur (zoals Roselaar 1977) gebaseerd op balgen, dus wintervogels. Er zijn geen vogels uit broedgebieden te vinden  in de musea in Leiden, Amsterdam en Tring (in deze heb ik recent rondgedwaald en rietganzen bekeken), waarvan nog maar aangetoond moet worden dat de betreffende labels kloppen. Dus ben voorzichtig met deze interpretatie.
 
Dank voor je nuancerende opmerking Justin. Maar merk op dat je bij de resultaten van Roselaar op pag. 63 wel een prachtige tweedeling ziet ontstaan, ongeacht of die beesten nu wel of niet juist gelabeld zijn - de vogels met de lange, dunne en bovendien goeddeels gele snavels blijken bij nagenoeg alle balgen ook juist de vogels met de lange tenen en de korte tarsi te zijn! En dat lijkt me toch te significant om te negeren.
 
Maar nogmaals, ik ben benieuwd waar Theo die lange poten bij fabalis vandaan tovert?
Titel: Re: rietgans, again...
Bericht door: gerdwichers8 op december 09, 2010, 23:43:19 pm
Nu we toch precies bezig zijn: Waarom wordt de bijvoeging 'geel' gesteld, voor een kleur die toch veel meer richting 'oranje' gaat?


Ligt misschien niet goed in het gehoor, of men breekt de tong er wat over: Zwartbek vs. Geelbek klinkt dan wel goed maar heeft natuurlijk niet zijn rechte toepassing.


(bedenk eens hoeveel Buizerds met een 'geelbruine' staart aangezien worden op een 'oranje' staart..)
Titel: Re: rietgans, again...
Bericht door: theomuusse op december 10, 2010, 09:30:25 am
De tabel is van iedereen!
Verbetere hem met alle plezier!

Theo
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 10, 2010, 10:14:50 am
Albert en PieterGeert hebben aangeboden een artikel voor de DB website te schrijven. Bedankt alvast!

You have got mail.

Ha Roel, ik geef je helemaal gelijk wat betreft je waarneming. De vogel heeft zijn snavel mee, omdat die overeenkomt met de meest gevonden kleurverdeling bij Taigarietgans: type B. Qua grootte zal de gans niet veel meer zijn geweest dan een kleine rietgans, op je foto afgaande. Omdat je verder geen details hebt genoteerd zou ik de soort inderdaad onzeker houden. Ik heb iets vergelijkbaars met deze (http://waarneming.nl/waarneming/view/41647153), hoewel we die toen met z'n drieën zeker een uur hebben gezien en deze later nog eens is gefotografeerd (http://alblas.waarneming.nl/waarneming/view/41668142). Let op de lage basis van de bovensnavel en de vorm van de ondersnavel. Overigens hadden veel van de Luisselvogels precies zo'n snavel in combinatie met zo'n klein wit streepje boven de snavel. Ik zie ze liever met meer dan vijf tegelijk!

Edit: @ Roel: verwacht niet veel nieuws in het stukkie tekst als je deze discussie grotendeels hebt gevolgd. Wat betreft de groep-periferie heb je gelijk, maar dat is geen inidividueel kenmerk wat in de tabel past. Er staat op één van de foto's inderdaad een ook aanwezige toendra. Plotje van 150.000 kolganzen?! Dat wil ik weleens zien.
Titel: Re: rietgans, again...
Bericht door: Roel Schwartz op december 10, 2010, 10:26:57 am
Ha Albert,


Bij je eerste waarneming  ( met deze) lijken het twee verschillende vogels te zijn, of is dat de lichtinval van de gemaakte foto. Ik bedoel dus met en zonder wit kolletje! Is het nog wat Albert om in de tabel met kenmerken te vermelden dat Taiga's naar het schijnt zich vrijwel altijd in de periferie van een Ganzengroep bevinden, ook al is het een groep Toendrarietganzen. Dit is misschien voor veel beginnenende vogelaars een goed kenmerk, om inderdaad ergens te beginnen met zoeken als je bij je eerste ganzentelling in een plotje voor een groep van 150000 kollen staat in januari. Ik ben trouwens nu al benieuwd naar jullie artikel. Ik denk dat het door heel erg veel vogelaars met grote belangstelling gelezen gaat worden. Veel succes met het schrijven ervan. Ik vogel eigenlijk alleen in het Azewijnsche Broek momenteel, onze uitdaging voor nu is om een raszuivere Taiga op de plaat te krijgen. Dus een uitsluitende foto! :duim:


Groetjes Roel.


 
Titel: Re: rietgans, again...
Bericht door: Cygnus op december 10, 2010, 12:42:33 pm
De aanduidingen geelbek en zwartbek voor respectievelijk Taiga- en Toendrarietgans worden al generaties lang gebruikt door ganzenvangers. Het is dus een term die al lang bestaat. 
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 10, 2010, 20:51:24 pm
Was dit al langsgekomen? http://birdingfrontiers.com/2010/12/08/bean-goose-salton-sea-part-3/
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 10, 2010, 21:42:15 pm
Ik ben het even kwijt. Die Californische vogel lijkt toch prima op een middendorfii?
 
Middendorfii staat die nu op zichzelf??
 
Ken Lethaby overigens goed (twee tripjes mee gedaan). Hij is een ex brit dus kent onze Toendra's en taiga's ook.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Ben Wielstra op december 11, 2010, 12:25:53 pm
Lees hier http://www.dutchbirding.nl/news.php?id=487 de bijdrage van PieterGeert en Albert!
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 12, 2010, 13:35:34 pm
Was dit al langsgekomen? http://birdingfrontiers.com/2010/12/08/bean-goose-salton-sea-part-3/ (http://birdingfrontiers.com/2010/12/08/bean-goose-salton-sea-part-3/)

Ja hoor. De allereerste foto riep meteen al vragen op die ik in geen van de postings zag beantwoord / gesteld.
 
(1): waarom geen escape / kweekgans, gezien de fraaie plaat van zeer dichtbij? Bij wilde Taigarietganzen in Nederland wil het maar niet lukken om dergelijke fraaie foto's te maken; ik heb ze in ieder geval nog niet gezien. M.i. wordt er in de VS ook veel gejaagd op ganzen.
 
(2): geen / nauwelijks aandacht voor relatie met groepsgenoten. En hoe zat het ook alweer met de leeftijd?
 
Klaas
 
Albert & PieterGeert, zeer bedankt voor jullie gedegen bijdrage op de site van DB. Net goed doorgelezen, maar een erg goed stuk! Komt het ook in het komende nummer van DB?
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 12, 2010, 17:02:58 pm
Nieuwe plek?
 
http://waarneming.nl/waarneming/view/51261611 (http://waarneming.nl/waarneming/view/51261611) witte buikstreep van een van de vogels: http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=4131&page=1  ook bij Luissel.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: nicky hulsbosch op december 12, 2010, 20:47:31 pm
Kwam deze foto toevallig tegen http://waarnemingen.be/foto/view/627077 (http://waarnemingen.be/foto/view/627077)
Titel: Re: rietgans, again...
Bericht door: Bas vd Burg op december 12, 2010, 20:57:12 pm
Nieuwe plek?
 
http://waarneming.nl/waarneming/view/51261611 (http://waarneming.nl/waarneming/view/51261611) witte buikstreep van een van de vogels: http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=4131&page=1 (http://www.dutchbirding.nl/gallery.php?p=bigpic&gal=2&fid=4131&page=1)  ook bij Luissel.
 
Groet Max

Niet helemaal een nieuwe plek Max, vorig jaar (maar ook andere jaren) werden in Vlijmen Taiga's waargenomen, zie http://waarneming.nl/gebied/view/149?g=0&from=2009-12-12&to=2010-12-12&sp=338&z=0&u=0&g=0&z=1&from=2000-12-12&to=2010-12-12 (http://waarneming.nl/gebied/view/149?g=0&from=2009-12-12&to=2010-12-12&sp=338&z=0&u=0&g=0&z=1&from=2000-12-12&to=2010-12-12)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 12, 2010, 21:29:58 pm
Nieuwe plek? http://waarneming.nl/waarneming/view/51261611 (http://waarneming.nl/waarneming/view/51261611)

Hmm. 1. Geen foto's. 2. Een zeer matige beschrijving (12 december 2010; losse waarneming; 26 ter plaatse. Minstens dit aantal grote rietganzen met oranje snavels). M.i. onvoldoende documentatie om ingeboekt te kunnen worden als Taigarietgans. Mee eens?
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op december 12, 2010, 21:32:05 pm
Nieuwe plek? http://waarneming.nl/waarneming/view/51261611 (http://waarneming.nl/waarneming/view/51261611)

Hmm. 1. Geen foto's. 2. Een zeer matige beschrijving (12 december 2010; losse waarneming; 26 ter plaatse. Minstens dit aantal grote rietganzen met oranje snavels). M.i. onvoldoende documentatie om ingeboekt te kunnen worden als Taigarietgans. Mee eens?
 
Groetjes, Klaas
Maar wel een waarnemer die donders goed weet waar hij het over heeft!
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 13, 2010, 16:55:01 pm
Nieuwe plek? http://waarneming.nl/waarneming/view/51261611 (http://waarneming.nl/waarneming/view/51261611)

Hmm. 1. Geen foto's. 2. Een zeer matige beschrijving (12 december 2010; losse waarneming; 26 ter plaatse. Minstens dit aantal grote rietganzen met oranje snavels). M.i. onvoldoende documentatie om ingeboekt te kunnen worden als Taigarietgans. Mee eens?
 
Groetjes, Klaas
Maar wel een waarnemer die donders goed weet waar hij het over heeft!

Inderdaad en mij lijkt de witte buikstreep vergelijkbaar met een ring, want zoveel rietganzen met een dergelijke 'sneeuwstreep' zullen er vast niet rond Den Bosch zitten! Een herkansing wellicht?

Over de vogel waar Nicky op wijst: solitair en dus per definitie lastig. Deze snavels komen óók voor bij toendra, zij het niet veel. Ter illustratie: Theo M. had er vandaag 1 tussen de 2100 toendra's in de Biesbosch. Verder is de onderkant van de snavel van de betreffende vogel toch wel uitgebogen tot ver richting de punt (foto linksboven). Niet pro taiga, zou ik zeggen. Lastig!

EDIT: Check (!): http://waarneming.nl/waarneming/view/51277179 (http://waarneming.nl/waarneming/view/51277179)

EDIT2: deze vond ik net. http://www.elisanet.fi/antero.lindholm/Linnut/Hanhet/ansfab.html
Titel: Re: rietgans, again...
Bericht door: Roel Schwartz op december 14, 2010, 15:14:36 pm
Edit: @ Roel: verwacht niet veel nieuws in het stukkie tekst als je deze discussie grotendeels hebt gevolgd. Wat betreft de groep-periferie heb je gelijk, maar dat is geen inidividueel kenmerk wat in de tabel past. Er staat op één van de foto's inderdaad een ook aanwezige toendra. Plotje van 150.000 kolganzen?! Dat wil ik weleens zien.


Oeps Albert, inderdaad 1 nulletje teveel. :o  Prachtig en duidelijk artikel trouwens van jullie op de website van de DBA. Mijn complimenten.




Titel: Re: rietgans, again...
Bericht door: theomuusse op december 14, 2010, 20:42:52 pm
Vandaag in Vlijmen met Albert de groep bekeken.
Opvallende zaken; de vogels zijn alert, duidelijk.
Ook zijn de vogels opvallend beheerst in hun bewegingen, ze lopen bedaard, komen erg rustig over.
Bovendien hebben ze de grauwe gans-waggel.
Behoorlijk veel vogels liggen. Enkele genten lopen/ waken, de rest eet zittend.
We zagen ondanks de afstand 3 eerste winter vogels.
De groep ligt duidelijk bijeen, slechts enkele kollen en de kleine riet waren naast 2 toendra's in de groep te vinden, allen aan de rand voor zover dat kan bij zo'n groepje.
De genten zijn echt erg groot vergeleken met de kollen. De lijven zijn langer en minder hoog, minder ovaal, dan van veel toendra's.
Witstreepje zat er ook nog bij.
De enige D-type vogel heeft verder niets verkeerds voor taiga.
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 20, 2010, 06:57:54 am
We zagen ondanks de afstand 3 eerste winter vogels.

Misschien is het bepalen van de exacte leeftijdsopbouw half december toch niet zo eenvoudig meer? Zie http://waarneming.nl/waarneming/view/51344144 (http://waarneming.nl/waarneming/view/51344144). Althans, als we aannemen dat familiegroepjes altijd uit adulten en 1w's bestaan natuurlijk. Met dank aan Lützen voor de suggestie!
Titel: Re: rietgans, again...
Bericht door: Robert de Boer op december 20, 2010, 09:25:00 am
http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf

Weet niet of deze link al eerder ergens in deze discussie staat. (veel te lange lijst om na te zien) maar ik vind hem wel handig.
Titel: Re: rietgans, again...
Bericht door: Jan vH op december 22, 2010, 17:34:57 pm
http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf (http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf)

Weet niet of deze link al eerder ergens in deze discussie staat. (veel te lange lijst om na te zien) maar ik vind hem wel handig.

Hij is inderdaad al een keertje langsgekomen, maar het is niet verkeerd om nog even wat aandacht op te vestigen.  :duim:
Titel: Re: rietgans, again...
Bericht door: theomuusse op december 22, 2010, 21:56:24 pm
We zagen ondanks de afstand 3 eerste winter vogels.

Misschien is het bepalen van de exacte leeftijdsopbouw half december toch niet zo eenvoudig meer? Zie http://waarneming.nl/waarneming/view/51344144 (http://waarneming.nl/waarneming/view/51344144). Althans, als we aannemen dat familiegroepjes altijd uit adulten en 1w's bestaan natuurlijk. Met dank aan Lützen voor de suggestie!

Albert en ik hebben de vogels niet heel dichtbij gezien.
Wel konden we bij 3 vogels nog de juveniele scapulars zien, tenminste een aantal veren, meest lower scapulars.
De ruggen komen daardoor rommeliger over en missen het strakke lijnenpatroon wat de meeste vogels tonen.

Theo
Titel: Re: rietgans, again...
Bericht door: theomuusse op december 22, 2010, 21:58:31 pm
Opvallend is dat er sinds de sterke toename hier in de Biesbosch van Toendra's, ook meer geler-genavelde en langer-gesnavelde vogels zijn bijgekomen. Die zaten er een week geleden nog niet. Ook 1 geringde trouwens.

Theo
Titel: Re: rietgans, again...
Bericht door: Adri Clements op december 22, 2010, 22:04:02 pm
@Theo: afgelopen dagen zeer sterke (sneeuw)trek van toendra's. Vandaag bij de zijdebrug tijdens zoektocht naar sneeuwuil een groep van 130 toendra's ri. ZW. Normaal zijn we al blij met een groep van 20.
Welke halsband? Afgelopen zaterdag over de telpost (kinderdijk) 1 toendra met gele halsband I..
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 23, 2010, 07:41:04 am
Misschien is het bepalen van de exacte leeftijdsopbouw half december toch niet zo eenvoudig meer? Zie http://waarneming.nl/waarneming/view/51344144 (http://waarneming.nl/waarneming/view/51344144). Althans, als we aannemen dat familiegroepjes altijd uit adulten en 1w's bestaan natuurlijk. Met dank aan Lützen voor de suggestie!

Albert en ik hebben de vogels niet heel dichtbij gezien.
Wel konden we bij 3 vogels nog de juveniele scapulars zien, tenminste een aantal veren, meest lower scapulars.
De ruggen komen daardoor rommeliger over en missen het strakke lijnenpatroon wat de meeste vogels tonen.

Theo

Inderdaad zitten (zaten?) er drie duidelijke 1w's Theo, maar wat ik wilde zeggen is dat er half december wellicht ook al vogels dusdanig doorgeruid zijn dat ze niet meer als zodanig te herkennen zijn. Het groepje van vijf in het bovenstaande linkje bijvoorbeeld bleef steeds bij elkaar, zelfs toen een vliegtuigje de boel door elkaar gooide. Dit wekt sterk de suggestie dat het een gezinnetje is. Maar een duidelijk jong beest zit er niet tussen!
 
Ook 1 geringde trouwens.
Toch geen rode of blauwe halsband hoop ik? Dan spring ik namelijk subiet in de auto...
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 23, 2010, 18:54:42 pm
De enige literatuur over het verschil tussen adult en 1e winter rietganzen is, voor zover ik kon nagaan, een artikel van J. van Impe. Ik heb gebeld naar een antiquariaat of ze het nummer hebben. Ze zoeken nog even voor me.
Van Impe, J. (1973) Bepaling in het veld van leeftijdsklassen bij de Rietgans Anser fabalis. Limosa,46, 192-–198.

Verder wordt er her en der terloops opgemerkt dat het verschil vanaf eind december nog maar erg lastig te bepalen. Je ziet inderdaad nu al aardig wat rietganzen waarvan alleen de dekveren nog zichtbaar juveniel zijn (http://waarneming.nl/fotonew/6/1744386.jpg), terwijl een enkeling nog maar een paar binnenste schouderveren heeft geruid. Volgens mij ruien ze de middelste en grote dekveren het laatst, waarna je geen enkel aanknopingspunt meer hebt. En de vorm en kleur van de randjes daarvan is op afstand moeilijk in te schatten.

Die geringde in de Biesbosch is gewoon geel hoor PieterGeert. Hij zat er vanmiddag nog, in een mooie groep (ca. 5000) met daartussen enkele grauwe ganzen met Scandinavische halsbanden en eentje van Heinicke.

Titel: Re: rietgans, again...
Bericht door: Justin Jansen op december 23, 2010, 19:56:10 pm
De enige literatuur over het verschil tussen adult en 1e winter rietganzen is, voor zover ik kon nagaan, een artikel van J. van Impe. Ik heb gebeld naar een antiquariaat of ze het nummer hebben. Ze zoeken nog even voor me.
Van Impe, J. (1973) Bepaling in het veld van leeftijdsklassen bij de Rietgans Anser fabalis. Limosa,46, 192-–198.

Verder wordt er her en der terloops opgemerkt dat het verschil vanaf eind december nog maar erg lastig te bepalen. Je ziet inderdaad nu al aardig wat rietganzen waarvan alleen de dekveren nog zichtbaar juveniel zijn (http://waarneming.nl/fotonew/6/1744386.jpg), terwijl een enkeling nog maar een paar binnenste schouderveren heeft geruid. Volgens mij ruien ze de middelste en grote dekveren het laatst, waarna je geen enkel aanknopingspunt meer hebt. En de vorm en kleur van de randjes daarvan is op afstand moeilijk in te schatten.

Die geringde in de Biesbosch is gewoon geel hoor PieterGeert. Hij zat er vanmiddag nog, in een mooie groep (ca. 5000) met daartussen enkele grauwe ganzen met Scandinavische halsbanden en eentje van Heinicke.


Stuur me ff een pm, met je mailadres stuur ik je het stuk wel op
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 23, 2010, 20:25:17 pm
De enige literatuur over het verschil tussen adult en 1e winter rietganzen is, voor zover ik kon nagaan, een artikel van J. van Impe. Ik heb gebeld naar een antiquariaat of ze het nummer hebben. Ze zoeken nog even voor me. Van Impe, J. (1973) Bepaling in het veld van leeftijdsklassen bij de Rietgans Anser fabalis. Limosa,46, 192-–198.
Op de laatste lezingendag van de NOU (Ljouwert, 23 oktober jl.) is door het bestuur van de NOU toegezegd dat op 1 januari 2011 alle artikelen etc. in alle afleveringen van Limosa via de website van de NOU / Limosa ( www.nou.nu (http://www.nou.nu) ) zijn te bekijken / down te loaden. Dan worden dit soort navragen een stuk makkelijker. Zie verder http://nou.natuurinfo.nl/website/limosa/limosa.htm (http://nou.natuurinfo.nl/website/limosa/limosa.htm) Ik wacht met spanning dit af. Voor wat betreft Ardea is dit echt een geweldige ontwikkeling geweest (alles in Ardea is al tijdenlang op deze manier te bekijken & down te loaden).
Titel: Re: rietgans, again...
Bericht door: HPM op december 23, 2010, 20:39:47 pm
Maar het zou een jaar geleden al gebeuren. Ik moet het dus eerst zien. Maar het zou wel fijn zijn.
Ik heb wel een heleboel jaargangen maar 1973 is te lang geleden.

Titel: Re: rietgans, again...
Bericht door: Cygnus op december 23, 2010, 21:14:51 pm
Hierbij het artikel van Van Impe uit 1973 (in 2 delen want de afzonderlijke delen waren te groot). Als je weer een artikel zoekt kun je dat misschien op dit forum vragen. Grote kans dat iemand het heeft.
 
De jongen van de rietganzen zijn moelijk te herkennen. Ik heb meer ervaring met Kleine Rietganzen. Daarvan kun je in het begin van het seizoen (t/m oktober) nog goede jongentellingen doen. Gaandeweg het seizoen wordt het echter steeds lastiger. Alleen een aantal in hun ontwikkeling achtergebleven jongen zijn nog goed te herkennen (zie bijvoorbeeld: http://www.rarebirdspain.net/irbsc429.jpg (http://www.rarebirdspain.net/irbsc429.jpg)). Bij rietganzen is het m.i. minimaal zo lastig in dit deel van het winterseizoen.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 23, 2010, 23:29:58 pm
Bedankt voor de moeite! Ik had het inderdaad gewoon hier moeten vragen. Het artikel noemt vijf kenmerken die alleen gecombineerd te gebruiken zijn om aan het begin van de winter het onderscheid te maken. Ik zeg: er valt dus letterlijk en figuurlijk nog wat te scoren op deze moeilijkheid.

Edit: Klaas, dat stuk kende ik al, maar bedankt. Koffijberg e.a. hebben wel een aantal kenmerken gescoord van 1e winter kolganzen. Iets vergelijkbaars is misschien ook met rietganzen te doen.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 24, 2010, 09:28:45 am
hoi Trinus, heel erg bedankt voor het inscannen ervan. Meteen gedownload en goed doorgelezen. Pfoeh, niet makkelijk dus. Ook goede observaties over gedrag van families.
 
hoi Albert en anderen, vier jaar geleden is een min of meer vergelijkbaar artikel gepubliceerd in Limosa over herkenning van eerstejaars Kolganzen: KOFFIJBERG K (2006) Herkenning en ruipatronen van eerstejaars Kolganzen in de winter. LIMOSA 79 : 163 - 168. Zie bijgaande pdf.
 
hoi Herman, klopt. De belofte wordt al geruime tijd gedaan. E-mails hierover worden niet beantwoord. Ach, is ook een manier om te melden dat het stokt / dat er ruzie is, etc.
 
Vriendelijke groeten,
 
Klaas
Titel: Re: rietgans, again...
Bericht door: HPM op december 24, 2010, 10:32:36 am
Voor het leesgemak heb ik de veldkenmerken van Van Impe in een tekstbestandje gezet.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op december 24, 2010, 11:24:38 am
hoi Albert,
 
Goed dat je het al kende. Maar nu staat ook dit artikel in ieder geval even als pdf online in deze draad over Taigarietganzen en kunnen anderen het ook gemakkelijk lezen / downloaden (zou kunnen dat deze pdf ook al wel op de site van Sovon staat, niet gecheckt). In de meest recente 'Kleine Zwanennieuws' (rondschrijfmail van Wim Tijsen) stond ook een mooie kopfoto van een Toendrarietgans. Het is in de hand toch heel anders dan in het veld. In de hand moet het leeftijdsonderscheid dus geen probleem zijn.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: hdijk op december 24, 2010, 17:47:37 pm
Wat zijn dit? : http://waarneming.nl/waarneming/view/51422154. (http://waarneming.nl/waarneming/view/51422154)
Ik zie er nl geen Taiga's in, maar da kan ook aan mij liggen...
Titel: Re: rietgans, again...
Bericht door: teunvankessel op december 24, 2010, 18:31:52 pm
Ik zou het ook geen taiga's noemen maar ganzen zijn niet echt mijn straatje.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 25, 2010, 23:27:02 pm
http://waarneming.nl/waarneming/view/51431495 (http://waarneming.nl/waarneming/view/51431495)
 
?? rare koptekening wel een goed lijkende snavel.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Vincent Hart op december 25, 2010, 23:30:22 pm
Idd, Max, zie ook p.8 van Foutieve Determinaties:
http://waarneming.nl/waarneming/view/51431495 (http://waarneming.nl/waarneming/view/51431495)
 
Deze   Taigarietganzen hebben wel een erg groot kleurverschil tussen donkere   kruin/nekstreep en lichte wangen. Zijn het geen Zwaanganshybriden?

Dat denk ik ook Gert-Jan, scherp gezien!
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op december 26, 2010, 17:41:49 pm
http://waarneming.nl/waarneming/view/51431495 (http://waarneming.nl/waarneming/view/51431495)
 
?? rare koptekening wel een goed lijkende snavel.
 
Groet Max
Zie het commentaar bij de waarneming. Waarschijnlijk hybride met Zwaangans.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 26, 2010, 17:44:32 pm
en inmiddels weer nieuw commentaar waarin Heinicke toch aan iets "woesters denkt..
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op december 26, 2010, 17:49:26 pm
en inmiddels weer nieuw commentaar waarin Heinicke toch aan iets "woesters denkt..
 
Groet Max
Waar lees jij dat?
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 26, 2010, 23:28:10 pm
eeeeh, open de link bij commentaren van moderator Marnix Jonker.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Cygnus op december 26, 2010, 23:38:12 pm
eeeeh, open de link bij commentaren van moderator Marnix Jonker.
 
Groet Max

Uuuh, welke link? Heb jij misschien speciale bevoegdheden die anderen niet hebben? Ik zie niks.
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op december 26, 2010, 23:40:53 pm
eeeeh, open de link bij commentaren van moderator Marnix Jonker.
 
Groet Max

Uuuh, welke link? Heb jij misschien speciale bevoegdheden die anderen niet hebben? Ik zie niks.
Volgens mij is Max toe aan slaap. Er staat toch echt dat Emo een mail gestuurd heeft aan Thomas H. omdat Emo denkt Suskins. Er is dus nog GEEN reactie van Thomas H.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 27, 2010, 00:00:37 am
Jeroen,
 
Je hebt gelijk, ik lees het verkeerd. Ik dacht dat Heinicke die reactie gaf maar het is hem gevraagd. Suskin's is overigens volgens mij al heel lang niet meer vastgesteld?? Hybride met Zwaangans is een optie hoewel ik zou verwachten dat je die er meer in zou moeten terug zien maar goed ik ga slapen.. te lang naar die trap gezocht...
 
Gr Max
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 27, 2010, 06:52:23 am
Jeroen,
 
Je hebt gelijk, ik lees het verkeerd. Ik dacht dat Heinicke die reactie gaf maar het is hem gevraagd. Suskin's is overigens volgens mij al heel lang niet meer vastgesteld?? Hybride met Zwaangans is een optie hoewel ik zou verwachten dat je die er meer in zou moeten terug zien maar goed ik ga slapen.. te lang naar die trap gezocht...
 
Gr Max

Volgens mij zie ik oranje snavels, terwijl Sushkins een roze snavel heeft. In de weinige beschrijvingen en illustraties die er van deze vorm (c.q. dit taxon) gemaakt zijn, zoals in Voous et al (1973) en Van den Bergh (2004), wordt bovendien niet gerept over een dergelijke koptekening. Overigens zijn er het afgelopen decennium nog wel degelijk enkele vogels met kenmerken van Sushkins in Nederland vastgesteld.
Titel: Re: rietgans, again...
Bericht door: PieWie op december 27, 2010, 08:56:07 am
Jeroen,
 
Je hebt gelijk, ik lees het verkeerd. Ik dacht dat Heinicke die reactie gaf maar het is hem gevraagd. Suskin's is overigens volgens mij al heel lang niet meer vastgesteld?? Hybride met Zwaangans is een optie hoewel ik zou verwachten dat je die er meer in zou moeten terug zien maar goed ik ga slapen.. te lang naar die trap gezocht...
 
Gr Max

Volgens mij zie ik oranje snavels, terwijl Sushkins een roze snavel heeft. In de weinige beschrijvingen en illustraties die er van deze vorm (c.q. dit taxon) gemaakt zijn, zoals in Voous et al (1973) en Van den Bergh (2004), wordt bovendien niet gerept over een dergelijke koptekening. Overigens zijn er het afgelopen decennium nog wel degelijk enkele vogels met kenmerken van Sushkins in Nederland vastgesteld.

Maar da's toch gewoon een variant waar wat mis is met het pigment in poten en snavel? Hierbij een plaatje van zo'n Sushkin uit de Wieringenmeer van een paar jaar geleden (heb de datum zo niet bij de hand). Er werd n.a.v. die waarneming beweerd dat er na het jaar 2000 regelmatig groepen tot 40 sushkins in dat gebied werden gezien. Mogelijk dat Bob Woets daar wat meer over weet?
 
Groeten,
 
Pierre
 
 
 
 
 
 
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op december 27, 2010, 09:08:35 am
Pieter Geert,
 
Waar komt Sushkins vandaan? Is het echt maar slechts een vorm? Kan het vast wel ergen vinden maar met het gevaar oude literatuur te raadplegen maar even de vraag hier. Ik vind het plaatje van Pierre overigens niet echt overtuigend.
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Marnix op december 27, 2010, 10:25:06 am
Voordat dit een eigen leven begint te lijden: Emo heeft de foto's die bij zijn waarneming staan even doorgestuurd naar Thomas Heinicke (wat hij wel vaker doet) om te vragen of dit nou vreemde Taigarietganzen zijn of dat het toch om een hybride met Zwaangans gaat. Omdat de vogel ook roze poten heeft vroeg hij er terloops ook even bij of het misschien om een 'sushkin' zou kunnen gaan. Hij denkt dus niet aan 'sushkin' oid.
 
Ik heb jaren terug dit plaatje eens van Emo gehad waar allerlei vormen van rietgans opstaan. Het is een oude plaat maar wel leuk en compleet. Copyright technisch mag het vast niet  :angel: , maar heb hem toch even bij deze post gedaan. Sushkin staat hier ook op, maar komt met snavelvorm en snavelkleur niet in de buurt van de vogels van Emo.
Titel: Re: rietgans, again...
Bericht door: gjcaspers op december 27, 2010, 13:57:31 pm
Dat is een plaat van Peter Scott uit Jean Delacour's The Waterfowl of the World.
 
De hybrideganzen op de foto's hebben op mijn beeldscherm oranje snavels en poten, en hebben dus niets van Sushkins. Ik denk inmiddels dat het "gewoon" hybriden Zwaangans x Grauwe Gans zijn, niet eens Zwaangans x rietgans. Dit op grond van het grote aandeel oranje op de snavels en de oogringetjes, die i.i.g. de rechter vogel lijkt te hebben. Opvallend is dan wel dat het op grond van lichaamsbouw en kopvorm om wildvorm Zwaangans lijkt te gaan, niet om gedomesticeerde Knobbelgans. Maar volgens mij wordt wildvorm Zwaangans nauwelijks gehouden.
 
Als dit soort beesten al aan Heinicke wordt voorgelegd met de vraag om wat voor rietgans het gaat, zal hij weinig vertrouwen in de Nederlandse Taigarietgansdeterminaties overhouden...
Titel: Re: rietgans, again...
Bericht door: lupokatja op december 27, 2010, 14:08:57 pm
Jeroen,
 
Je hebt gelijk, ik lees het verkeerd. Ik dacht dat Heinicke die reactie gaf maar het is hem gevraagd. Suskin's is overigens volgens mij al heel lang niet meer vastgesteld?? Hybride met Zwaangans is een optie hoewel ik zou verwachten dat je die er meer in zou moeten terug zien maar goed ik ga slapen.. te lang naar die trap gezocht...
 
Gr Max

Volgens mij zie ik oranje snavels, terwijl Sushkins een roze snavel heeft. In de weinige beschrijvingen en illustraties die er van deze vorm (c.q. dit taxon) gemaakt zijn, zoals in Voous et al (1973) en Van den Bergh (2004), wordt bovendien niet gerept over een dergelijke koptekening. Overigens zijn er het afgelopen decennium nog wel degelijk enkele vogels met kenmerken van Sushkins in Nederland vastgesteld.

Maar da's toch gewoon een variant waar wat mis is met het pigment in poten en snavel? Hierbij een plaatje van zo'n Sushkin uit de Wieringenmeer van een paar jaar geleden (heb de datum zo niet bij de hand). Er werd n.a.v. die waarneming beweerd dat er na het jaar 2000 regelmatig groepen tot 40 sushkins in dat gebied werden gezien. Mogelijk dat Bob Woets daar wat meer over weet?
 
Groeten,
 
Pierre

Heb de foto al eerder gezien, maar ik bedenk me nu pas dat dit vermoedelijk een Kleine Rietgans is? Brede witte staartband past bijv. niet echt goed op Toendra/Taigarietgans en ik zie verder wel meer kenmerken die beter op een Kleine Rietgans passen.

Is er wat meer te vertellen over die Zwaangans-hybriden (zie zelf niet hoe daar een Suskins van gemaakt moet worden), welke andere soorten zaten er in de groep etc...? Broedgebieden van Zwaangans liggen wel erg ver weg, maar is er een kans dat het een wilde hybride betreft?

Lützen
Titel: Re: rietgans, again...
Bericht door: Marnix op december 27, 2010, 16:35:44 pm
Deze zien er weer erg goed uit: http://waarneming.nl/waarneming/view/51462258 (http://waarneming.nl/waarneming/view/51462258)
 
Ik heb vanmiddag nog naar deze vogels lopen zoeken, maar ze helaas niet terug kunnen vinden.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 27, 2010, 17:06:36 pm
Waarom halen we de benaming 'suhskins' weer uit de kast? Dat is net zoiets als 'omissus' blijven zeggen tegen geelpotige zilvermeeuwen. Dan kun je het beter hebben over bijvoorbeeld een fabalis met een roze snavel en roze poten. Ik heb een artikel over de Nederlandse balgen van 'sushkins' van Voous e.a. uit 1973 al eens als bijlage in een vorig topic gezet. Voous schrijft: 'eerder handelt het om een verliesmutatie, die in iedere rietganspopulatie kan optreden en die niet eens altijd op de kleur van de snavel en poten gelijktijdig betrekking heeft.'

Sushkin is een vorm die door P. Sushkin in 1895 werd beschreven op basis van vogels in het wintergebied. Sindsdien is de vorm altijd bediscussieerd geweest en door bijna alle taxonomen niet als valide taxon aangemerkt.

Verder ben ik het helemaal eens met de opmerking van Gert-Jan over de hybriden en die van Lutzen over de vogel uit Wieringermeer.

Titel: Re: rietgans, again...
Bericht door: Justin Jansen op december 27, 2010, 17:45:59 pm
Voor taxonomische benoeming zie post 373 en voor de foto van Peter Scott zie past 281.
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 27, 2010, 19:46:28 pm
@ Max: Je vragen zijn grotendeels reeds beantwoord. De stelling dat neglectus een vorm (lees: mutatie) is, lijkt momenteel de beste papieren te hebben. Deze theorie wordt behalve door het bestaan van 'halve Sushkins' (roze snavel en oranje poten, ook wel carneirostris genoemd), ook ondersteund door het feit dat er zowel rossicus- als fabalis-achtige Sushkinsganzen zijn gezien. Het voornaamste argument dat Van den Bergh (2004) hiertegen in stelling brengt, is het optreden van complete families en groepen. Zo zouden er in Hongarije begin vorige eeuw nog duizenden hebben overwinterd. De grootste mij bekende groep in Nederland bedroeg 38 exx. in de Wieringermeer, winter 2003/2004. Hoe betrouwbaar deze waarnemingen zijn en of er pogingen zijn gedaan tot documentatie weet ik niet.
 
@ Lützen: Ik ben nog niet helemaal overtuigd. Een klassieke neglectus is het zeker niet, maar dat postuur... En de staart vind ik akelig lastig te beoordelen zo, of heb jij nog meer plaatjes gezien?
 
@ Albert: Wat is er tegen op de benaming 'Sushkins'? Een geelpotige Zilver met bandje op P5 en mooie tongen noem ik omissus, en een rietgans met roze snavel en poten neglectus, so what?
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 27, 2010, 20:10:05 pm

 @ Albert: Wat is er tegen op de benaming 'Sushkins'? Een geelpotige Zilver met bandje op P5 en mooie tongen noem ik omissus, en een rietgans met roze snavel en poten neglectus, so what?

Dat is een meningskwestie. Ik schreef het omdat je dan vasthoudt aan benamingen die alleen maar een variatie binnen een (onder)soort aanduiden. Dat zorgt volgens mij in de praktijk voor verwarring. Zeker in de rietganzendiscussie met z'n enorm 'rijke' naamgevingsverleden. In mijn notitieboekje schrijf ik nog wel stiekem 'omissus-type' of 'vooral geelbekken', maar hier laat ik dat. Misschien een vreemde hypocrisie van me  :-\ .
Titel: Re: rietgans, again...
Bericht door: lupokatja op december 27, 2010, 21:37:51 pm
@ Lützen: Ik ben nog niet helemaal overtuigd. Een klassieke neglectus is het zeker niet, maar dat postuur... En de staart vind ik akelig lastig te beoordelen zo, of heb jij nog meer plaatjes gezien?

Ik ken geen andere foto´s dan deze, maar wat ik denk dat de staartband is lijkt mij voornamelijk wit. Ook qua kleurstelling lijkt het mij toch eerder een (juveniele) Kleine Rietgans. Weet niet of deze club je al eens is opgevallen:

http://waarneming.nl/waarneming/view/51223857 (http://waarneming.nl/waarneming/view/51223857)

Een zelfde (of dezelfde vogel) is daar al een paar keer eerder gefotografeerd en als Toendrarietgans ingevoerd. Weet niet of het steeds dezelfde is (of van hetzelfde familiegroepje), maar bijv. deze foto (http://waarneming.nl/fotonew/9/1727249.jpg (http://waarneming.nl/fotonew/9/1727249.jpg)) laat volgens mij toch een Kleine Rietgans zien met een behoorlijk Rietgans postuur.

Lützen

ps. Deel van de Taiga's is volgens mij nog steeds aanwezig rondom Den Bosch (zowel in de Gement als in polder Bokhoven). Vogels zitten erg ver weg en het gebied was de afgelopen dagen slecht begaanbaar.
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op december 28, 2010, 13:09:01 pm
Ik krijg net bericht van PieterGeert dat Henk-Jan van der Kolk 8 zeker taiga's heeft bij Heteren, vanaf de N837. Wellicht volgt meer info.

Waarschijnlijk kan ik vanmiddag even langs Vught om op de melding daar af te gaan.
Titel: Re: rietgans, again...
Bericht door: frankw op december 28, 2010, 16:02:11 pm
http://waarneming.nl/waarneming/view/51478584 (http://waarneming.nl/waarneming/view/51478584)
Titel: Re: rietgans, again...
Bericht door: migratorius op december 28, 2010, 18:45:45 pm
ps. Deel van de Taiga's is volgens mij nog steeds aanwezig rondom Den Bosch (zowel in de Gement als in polder Bokhoven). Vogels zitten erg ver weg en het gebied was de afgelopen dagen slecht begaanbaar.
Heb maandag Vlijmensch Ven, omgeving Bokhoven en vervolgens Luissel afgezocht zonder succes (wel een Kleine Rietgans net ten noorden van Vlijmen, ook leuk). Sommige groepen zaten inderdaad erg ver weg. Alleen in Luissel was de weg gevaarlijk glad.
Vanmiddag kort in St.-Michielsgestel gekeken (daar was de weg zo mogelijk nog gladder dan in Luissel) zonder succes, alvorens naar Heteren te rijden: kan-ie eindelijk (weer) op mijn lijst...

JanHein
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op december 28, 2010, 19:58:47 pm
Ik ken geen andere foto´s dan deze, maar wat ik denk dat de staartband is lijkt mij voornamelijk wit. Ook qua kleurstelling lijkt het mij toch eerder een (juveniele) Kleine Rietgans. Weet niet of deze club je al eens is opgevallen:

http://waarneming.nl/waarneming/view/51223857 (http://waarneming.nl/waarneming/view/51223857)

Een zelfde (of dezelfde vogel) is daar al een paar keer eerder gefotografeerd en als Toendrarietgans ingevoerd. Weet niet of het steeds dezelfde is (of van hetzelfde familiegroepje), maar bijv. deze foto (http://waarneming.nl/fotonew/9/1727249.jpg (http://waarneming.nl/fotonew/9/1727249.jpg)) laat volgens mij toch een Kleine Rietgans zien met een behoorlijk Rietgans postuur.

Na de foto van Pierre even uitvergroot te hebben, denk ik dat je gelijk hebt Lutzen. De vogels waar je nu naar linkt lijken me inderdaad prima Kleine Rieten, al heb ik me wel eens laten vertellen dat er in het Westland ook enkele hybriden Toendra x Kleine rondlopen!
Titel: Re: rietgans, again...
Bericht door: August op december 28, 2010, 20:27:46 pm
http://waarneming.nl/gebied/view/6259?from=2000-01-01&to=2010-12-28&sp=1384&g=1&u=0
Geloof deze escape,'s in het westland
Titel: Re: rietgans, again...
Bericht door: August op december 28, 2010, 20:30:10 pm
http://waarneming.nl/gebied/view/6259?from=2000-01-01&to=2010-12-28&sp=341&g=1&u=0
En deze uit het Westland.
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 01, 2011, 19:55:31 pm
    Een quiz om het nieuwe jaar mee te beginnen. Hoeveel  Taigarietganzen lopen er eigenlijk rond in dit video-fragment van Marnix?
 
  http://www.youtube.com/v/yuUrn5jhkY0
 
  Lutzen
Titel: Re: rietgans, again...
Bericht door: Justin Jansen op januari 01, 2011, 20:32:53 pm
Zo (http://waarneming.nl/waarneming/view/51551543#) hoort dus een klassieke vogel eruit te zien? Gaaf beest.
Titel: Re: rietgans, again...
Bericht door: Timo Roeke op januari 01, 2011, 20:52:51 pm
Vandaag ook in Twente. Kan iemand hier iets over zeggen.
http://tvwg.waarneming.nl/waarneming/view/51548786 (http://tvwg.waarneming.nl/waarneming/view/51548786)
Titel: Re: rietgans, again...
Bericht door: Robertmeer op januari 01, 2011, 21:47:48 pm
Vandaag ook in Twente. Kan iemand hier iets over zeggen.
http://tvwg.waarneming.nl/waarneming/view/51548786 (http://tvwg.waarneming.nl/waarneming/view/51548786)
Met zulke foto's wordt het ons niet echt makkelijk gemaakt.
Titel: Re: rietgans, again...
Bericht door: henkjanvdkolk op januari 01, 2011, 22:17:08 pm
Zo (http://waarneming.nl/waarneming/view/51551543#) hoort dus een klassieke vogel eruit te zien? Gaaf beest.

Op de foto zijn niet alle details te zien, maar ziet er inderdaad goed uit!
Zelfde idee als jouw vogels (Noord-Holland, tussen kolganzen)? http://waarneming.nl/waarneming/view/46380999 (http://waarneming.nl/waarneming/view/46380999)
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 01, 2011, 22:41:08 pm
Vandaag ook in Twente. Kan iemand hier iets over zeggen.
http://tvwg.waarneming.nl/waarneming/view/51548786 (http://tvwg.waarneming.nl/waarneming/view/51548786)

Op de onderste foto ziet de 2e vogel van rechts er volgens mij heel goed uit.

Lutzen
Titel: Re: rietgans, again...
Bericht door: Timo Roeke op januari 02, 2011, 10:17:46 am
Ik vind het erg lastig met deze kwaliteit foto's.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 02, 2011, 12:05:50 pm
Ik vind het erg lastig met deze kwaliteit foto's.
Ik ook.
 
De Amerikaanse vogelaars / fotografen komen wel met een geweldige foto van een 'rare' Rietgans die aan de westkust opdook. Zie eerder in deze draad.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Cygnus op januari 02, 2011, 12:17:34 pm
Als een determinatie mogelijk is op basis van die foto's, dan hoeft determineren van vliegende "rietganzen" ook geen enkel probleem meer te zijn.
Titel: Re: rietgans, again...
Bericht door: Timo Roeke op januari 02, 2011, 17:24:01 pm
Vandaag heb ik en een andere waarnemer deze vogels gezien:
http://tvwg.waarneming.nl/waarneming/view/51563156 (http://tvwg.waarneming.nl/waarneming/view/51563156)
Titel: Re: rietgans, again...
Bericht door: Albert de Jong op januari 02, 2011, 19:30:09 pm
Zo (http://waarneming.nl/waarneming/view/51551543#) hoort dus een klassieke vogel eruit te zien? Gaaf beest.

Op de foto zijn niet alle details te zien, maar ziet er inderdaad goed uit!
Zelfde idee als jouw vogels (Noord-Holland, tussen kolganzen)? http://waarneming.nl/waarneming/view/46380999 (http://waarneming.nl/waarneming/view/46380999)

Dan valt je toch op dat ook die vogels de typische 'zwanenbult' - om toch dat woord vast te houden - en niet eens een heel lange snavel blijken te hebben. De snavel op de onderste foto is vergelijkbaar met die van de eendenkoppies onderin deze pagina: http://www2.birdphotos.dk/birds/saedgaas.htm (http://www2.birdphotos.dk/birds/saedgaas.htm)

Ik plaats de link hier ook omdat er goede vluchtbeelden te vinden zijn. Op basis van vele online vluchtfoto's en eigen waarnemingen denk ik dat een aardige indicatie om aan te houden is, dat taiga's (zeker mannetjes) een recht stukje in de hals hebben, terwijl toendra's dat missen. Om dat duidelijk te maken, het tekeningetje van de vliegende gans in het volgende plaatje: http://www.pbase.com/albertdejong/image/109646374 (http://www.pbase.com/albertdejong/image/109646374). Verder is het plaatje op wat punten achterhaald.
Titel: Re: rietgans, again...
Bericht door: Max Berlijn op januari 02, 2011, 20:59:28 pm
Het valt me wel op dat de laatste twee weken het aantal meldingen redelijk uit de hand loopt. Zie bijv de oogst van vandaag: http://waarneming.nl/soort/view/338?from=2011-01-02&to=2011-01-02 (http://waarneming.nl/soort/view/338?from=2011-01-02&to=2011-01-02)
De meeste (niet alle) vogels zien er goed uit op de foto's die er zijn.
 
Zitten er deze winter meer? (Het is zelfs meer dan ik had kunnen dromen (zie mijn aantalschattingen voor de Luissel vogels gevonden werden in dit topic), of weten we eindelijk hoe het moet?
 
Groet Max
Titel: Re: rietgans, again...
Bericht door: Jeroen Nagtegaal op januari 02, 2011, 21:01:52 pm
Ik denk vooral dat mensen  meer foto's maken en actiever zoeken nu de soort op zeldzaam staat.
Titel: Re: rietgans, again...
Bericht door: edwin de weerd op januari 02, 2011, 21:12:34 pm
Ik denk dat er vooral meer sneeuw ligt bij de oosterburen. (meer als vorig winter?)
 
Edwin.
Titel: Re: rietgans, again...
Bericht door: Marnix op januari 02, 2011, 21:19:01 pm
Dat ben ik met Edwin eens. We hebben voor het eerst in jaren weer eens redelijk wat sneeuw. Hier, maar ook ten noorden en oosten van ons.
Begin vorig jaar winterde het flink, en prompt hebben we Taigarietganzen. En dit lijkt zich nu te herhalen. Het klopt dat we de laatste 10-15 jaar niet zoveel sneeuw meer gehad hebben, en dus ook veel minder Taiga's.
 
Overigens heb ik via Thomas Heinicke vernomen dat er momenteel in elk geval 3 Toendrarietganzen uit Scandinavie momenteel in NL zitten (2 Zweden en 1 Noor). Dit is ook uitzondelijk, want meestal blijven die vogels in Scandinavie hangen. Dus waarschijnlijk zijn er ook Taiga's uit Scandinavie meegekomen.
Titel: Re: rietgans, again...
Bericht door: Jan vH op januari 03, 2011, 07:49:22 am
Het is altijd al zo dat de aantallen die gemeld worden op Waarneming.nl in januari een stuk hoger zijn dan in december, kijk maar eens naar de statistieken (http://waarneming.nl/soort/stats/338?tab=&id=&user=0&year=0&month=0&sex=0). Dat zal natuurlijk ook met de sneeuw te maken hebben. Verder zal, naast de al genoemde dingen, meespelen dat het een goede dag was om te gaan zoeken.
Titel: Re: rietgans, again...
Bericht door: GertJ op januari 03, 2011, 08:11:46 am
Het is altijd al zo dat de aantallen die gemeld worden op Waarneming.nl in januari een stuk hoger zijn dan in december, kijk maar eens naar de statistieken (http://waarneming.nl/soort/stats/338?tab=&id=&user=0&year=0&month=0&sex=0). Dat zal natuurlijk ook met de sneeuw te maken hebben. Verder zal, naast de al genoemde dingen, meespelen dat het een goede dag was om te gaan zoeken.
Daar zal ook nog een factor jaarlijsten meespelen is mijn inschatting.
 
Titel: Re: rietgans, again...
Bericht door: Maarten Hotting op januari 04, 2011, 23:21:08 pm
Hier een beschrijving met foto´s en meteen een bevestiging van de determinatie van de door mij gevonden Taiga´s in Polder de Purmer bij Purmerend gisteren!!
http://waarneming.nl/waarneming/view/51591440 (http://waarneming.nl/waarneming/view/51591440)
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 09, 2011, 18:07:35 pm
Op www.lauwersmeer.com (http://www.lauwersmeer.com) staan ook een aantal mooie foto's van Ipe Weeber van 3 januari 2011, genomen bij Zuidlaarderveen. Op een akker. Zie http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&landid=&add=20110106 (http://www.lauwersmeer.com/php/fotokl.php?soort=vogel&vogelnr=271&taal=nl&landid=&add=20110106) voor de directe link.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 09, 2011, 22:23:25 pm
En zie ook de duidelijke foto's van 8 januari jl. uit de Wieringermeer van Fred Visscher op http://wierhaven.waarneming.nl/waarneming/view/51677531 (http://wierhaven.waarneming.nl/waarneming/view/51677531)
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 10, 2011, 04:48:39 am
Fraaie foto's zijn het wel Klaas, maar fraaie Taiga's vind ik het niet...
 
Dit is trouwens wel spannend: http://waarneming.nl/waarneming/view/51712865 (http://waarneming.nl/waarneming/view/51712865). Misschien zitten ze er nog wel gewoon?
Titel: Re: rietgans, again...
Bericht door: jvdlaan op januari 10, 2011, 16:25:24 pm
Fraaie foto's zijn het wel Klaas, maar fraaie Taiga's vind ik het niet...
 
Dit is trouwens wel spannend: http://waarneming.nl/waarneming/view/51712865 (http://waarneming.nl/waarneming/view/51712865). Misschien zitten ze er nog wel gewoon?

Die van Wieringen kan inderdaad een aardige sigaar in zijn mondhoek proppen zonder zijn snavel open te doen.
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 10, 2011, 16:46:11 pm
Fraaie foto's zijn het wel Klaas, maar fraaie Taiga's vind ik het niet...
 
Dit is trouwens wel spannend: http://waarneming.nl/waarneming/view/51712865 (http://waarneming.nl/waarneming/view/51712865). Misschien zitten ze er nog wel gewoon?

Ja hoor dat doen ze:
http://waarneming.nl/waarneming/view/51779002

en ik denk toch echt dat dit een Taigarietgans is:
http://waarneming.nl/waarneming/view/51551543 (http://waarneming.nl/waarneming/view/51551543)   

en wat denken jullie, hebben de Belgen er een laten lopen?
http://waarnemingen.be/waarneming/view/51431170 (http://waarnemingen.be/waarneming/view/51431170)   


Lutzen
Titel: Re: rietgans, again...
Bericht door: Folkert Jan op januari 10, 2011, 20:34:10 pm
Fraaie foto's zijn het wel Klaas, maar fraaie Taiga's vind ik het niet...
 
Dit is trouwens wel spannend: http://waarneming.nl/waarneming/view/51712865 (http://waarneming.nl/waarneming/view/51712865). Misschien zitten ze er nog wel gewoon?

en ik denk toch echt dat dit een Taigarietgans is:
http://waarneming.nl/waarneming/view/51551543 (http://waarneming.nl/waarneming/view/51551543)   

Lutzen

Wat een kleintje!
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 11, 2011, 06:53:38 am
Ja hoor dat doen ze:
http://waarneming.nl/waarneming/view/51779002 (http://waarneming.nl/waarneming/view/51779002)

en ik denk toch echt dat dit een Taigarietgans is:
http://waarneming.nl/waarneming/view/51551543 (http://waarneming.nl/waarneming/view/51551543)   

en wat denken jullie, hebben de Belgen er een laten lopen?
http://waarnemingen.be/waarneming/view/51431170 (http://waarnemingen.be/waarneming/view/51431170)   

Gaaf dat ze er nog steeds zitten, Lützen! Zelfs op zulke baggerplaatjes springen ze er nog uit  ;) . Ook die 'bananenbek' uit België ziet er natuurlijk uit als een klassieke vogel.
 
Wat betreft de door jou aangehaalde foto van Pierre van der Wielen (en datzelfde geldt voor de foto van Fred Visscher op dutchbirding.nl): wat mij betreft zeker een kandidaat, maar wel een vogel die net niet op álle punten goed scoort. En voor een vogel die tussen de Taiga's zit vind ik dat geen enkel bezwaar, die dingen zijn gewoon variabel. Maar als zo'n geval dan ook nog als los exemplaar bij een groep Toendra's zit, zou hij bij mij minstens in het laatje 'rietgans spec.' belanden. Ter illustratie een niet-standaard Taiga (maar wel tussen de Taiga's): http://waarneming.nl/foto/view/1782055 (http://waarneming.nl/foto/view/1782055) en twee rietgans specs (tussen de Toendra's): http://waarneming.nl/foto/view/628642 (http://waarneming.nl/foto/view/628642) en http://waarneming.nl/foto/view/1050510 (http://waarneming.nl/foto/view/1050510).
Titel: Re: rietgans, again...
Bericht door: PieWie op januari 11, 2011, 09:06:30 am

Wat betreft de door jou aangehaalde foto van Pierre van der Wielen (en datzelfde geldt voor de foto van Fred Visscher op dutchbirding.nl): wat mij betreft zeker een kandidaat, maar wel een vogel die net niet op álle punten goed scoort.

Volgens Thomas H. is 'mijn' vogel een oranje-snavelige toendra. Argumenten zijn nog niet helemaal overtuigend (hij schat de grootte verkeerd in) maar op verzoek heb ik de determinatie omgezet naar een toendra. Veel van de argumenten tegen een taiga zoals de grootte, bouw, kleur kop en kopvorm passen ook erg goed op Fred zijn vogel. Dat zou er dan hoogstwaarschijnlijk ook geen zijn. Ik begreep wel dat de foto's ook naar Thomas zijn gestuurd. Ben erg benieuwd naar de uitkomst.
 
Groeten,
 
Pierre
 
 
Titel: Re: rietgans, again...
Bericht door: Fred Visscher op januari 11, 2011, 10:11:07 am
Pierre,
Als je het commentaar van Albert leest zijn er juist vrijwel geen argumenten tegen een vrouw taiga en zie ook de 2 zwart/wit foto's hier http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf (http://www.sovon.nl/pdf/heinicke_presentatie_rietgansdeterminatie_sovondag.pdf)
Ik denk eerder dat verwarring ontstaat omdat dit vrijwel de eerste goede platen zijn van een eventuele"vrouw taiga", en dat dus even wennen is ik kan ze iig nergens vinden op zowel de db site of op waarneming.nl(waar overigens ook nog eens zo'n 85% van de foto's toendra's toont m.i
Het is zo makkelijk nog niet idd,maar zoals je al aangeeft we wachten Thomas nog even af,maar vind met alle argumenten van Albert en mijn eigen ervaring bij deze vogel het wel duidelijk genoeg eigenlijk.
Nu nog eens foto's van vlijmen of andere bekende plekken waar je wat aan hebt want ik kan er weinig mee,ik heb ook foto's van toendra,s op afstand gemaakt in  het verleden met lange nek en lang ogende snavels en dan met een flinke crop lijkt het allemaal heel wat ja.
En met het rijtje kenmerken van taiga is die van een lange nek nog de lastigste omdat je hier in  het veld en met name op afstand niet veel mee kan,wel de dikte is goed in te schatten met de toendra's er omheen.
Neem nou bv deze foto http://waarneming.nl/foto/view/1782908 (http://waarneming.nl/foto/view/1782908) die worden met regelmaat van flinke afstand genomen of nog erger gedigiscoopt van een nog grotere afstand en tja als hij of ze er dan met een wat uitgerekte hals opstaan dan lijkt het wel weer een taiga,daarom denk ik dat je echt alleen maar wat kan zeggen en ook over groepjes in goede gebieden,als er dus duidelijke foto's zijn.
Er zitten overigens zo'n 30.000 rietganzen in de wieringermeerpolder,het zou niet zo gek zijn als er ook 1 of meer taiga's zijn neergedaald.
 
Fred
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 11, 2011, 12:23:54 pm
Ja hoor dat doen ze:
http://waarneming.nl/waarneming/view/51779002 (http://waarneming.nl/waarneming/view/51779002)

en ik denk toch echt dat dit een Taigarietgans is:
http://waarneming.nl/waarneming/view/51551543 (http://waarneming.nl/waarneming/view/51551543)   

en wat denken jullie, hebben de Belgen er een laten lopen?
http://waarnemingen.be/waarneming/view/51431170 (http://waarnemingen.be/waarneming/view/51431170)   

Gaaf dat ze er nog steeds zitten, Lützen! Zelfs op zulke baggerplaatjes springen ze er nog uit  ;) . Ook die 'bananenbek' uit België ziet er natuurlijk uit als een klassieke vogel.
 
Wat betreft de door jou aangehaalde foto van Pierre van der Wielen (en datzelfde geldt voor de foto van Fred Visscher op dutchbirding.nl): wat mij betreft zeker een kandidaat, maar wel een vogel die net niet op álle punten goed scoort. En voor een vogel die tussen de Taiga's zit vind ik dat geen enkel bezwaar, die dingen zijn gewoon variabel. Maar als zo'n geval dan ook nog als los exemplaar bij een groep Toendra's zit, zou hij bij mij minstens in het laatje 'rietgans spec.' belanden. Ter illustratie een niet-standaard Taiga (maar wel tussen de Taiga's): http://waarneming.nl/foto/view/1782055 (http://waarneming.nl/foto/view/1782055) en twee rietgans specs (tussen de Toendra's): http://waarneming.nl/foto/view/628642 (http://waarneming.nl/foto/view/628642) en http://waarneming.nl/foto/view/1050510 (http://waarneming.nl/foto/view/1050510).

Dat uitspringen is overigens relatief. Vogels zijn volgens mij niet weggeweest, of beter gezegd, er zijn de afgelopen 2-3 weken steeds meerdere Taigarietganzen rond Den Bosch aanwezig geweest. Ook deze vogels vallen niet perse heel erg op in een grote groep Toendras op flinke afstand. Misschien nuttig om dit artikel van Sibley te lezen:

http://www.sibleyguides.com/2007/09/ambiguity-and-bird-identification/

Ik weet dat ik een ketter ben op dit gebied, maar is het nou echt nodig om zoveel slagen om de arm te houden?

http://waarneming.nl/foto/view/628642 (http://waarneming.nl/foto/view/628642)
http://www.birdnet.fi/data/kuvat/20080329_171342__W5L9445.jpg

sowieso misschien nuttig voor anderen om deze eens te bekijken:
http://www.birdnet.fi/lintu.php?lintu_id=112
(en ja. ik weet dat er ook Toendras in Finland rondlopen)


Weet niet of Thomas alle Taiga's op club300.de persoonlijk heeft goedgekeurd, maar ook deze staan er gewoon tussen:
http://www.club300.de/gallery/photo.php?id=8658
http://www.club300.de/gallery/photo.php?id=12546

en deze dan:
http://www.club300.de/gallery/photo.php?id=16924
iemand voor rechts wel? links niet?

Ik ben bang dat het toch allemaal niet zo simpel is.

Lützen
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 11, 2011, 22:52:47 pm
Een van de weinige keren dat ik een redelijk klassieke, en overigens ook niet al te grote, vogel wat dichter langs de kant van de weg kon fotograferen (al blijft de kwaliteit beroerd):
http://waarneming.nl/waarneming/view/51799985 (http://waarneming.nl/waarneming/view/51799985)
Het is trouwens zeker niet zo dat ik weer terug wil naar de situatie waarin iedereen maar wat invoert en er verder geen enkele toetsing plaatsvindt.  Wel denk ik dat er te vaak van wordt uitgegaan dat een niet-klassieke vogel met Taiga-trekjes dus een Toendra is en dat lijkt me net zo min juist. Een waarneming met een foto van een vogel als in http://waarneming.nl/fotonew/0/1779300.jpg (http://waarneming.nl/fotonew/0/1779300.jpg) goedkeuren als Toendra is wat mij betreft echt een flink aantal bruggen te ver. Een eerdere vergelijkbare vogel is overigens (nog) niet goedgekeurd: http://waarneming.nl/fotonew/0/1764600.jpg (http://waarneming.nl/fotonew/0/1764600.jpg).
Ook over de “andere” vogel van Fred heb ik zo m’n twijfels: http://waarneming.nl/waarneming/view/51677531 (http://waarneming.nl/waarneming/view/51677531). Natuurlijk zie ik ook wel waarom er aan Toendra gedacht wordt, maar is dat al voldoende om hem dan ook als zodanig goed te keuren? Dit soort foto’s zijn toch een statement betreffende de variabiliteit van Toendra dan wel Taiga waarover deze waarnemers (met alle respect hoor, ik schaar mijzelf daar ook onder en heb mezelf daar meermalen aan heb bezondigd) toch nauwelijks kunnen oordelen?  Denk dat dit soort vogels als Rietgans spec. of eventueel zelfs als Taiga met een vraagteken moet worden ingevoerd.
Misschien een beetje een “fishing expedition”, maar wellicht is het de moeite waard om deze vogels in polder Oudenhoorn eens goed te bekijken?
http://waarneming.nl/fotonew/4/1782194.jpg (http://waarneming.nl/fotonew/4/1782194.jpg)
 
Lützen
Titel: Re: rietgans, again...
Bericht door: g.j.p.gelderblom op januari 12, 2011, 06:50:36 am
@ Fred: Jij stelt: "Het is een Taiga, maar omdat dit de eerste goede foto's van een vrouw Taiga zijn, weten jullie gewoon niet hoe zo'n beest eruit ziet." Misschien een beetje flauw, maar toch: als alle eerder gefotografeerde vogels (ook in de broedgebieden) dan blijkbaar mannetjes zijn, hoe weet jij zelf dan eigenlijk hoe een vrouwtje eruit ziet? Begrijp me goed: ook ik zie bij deze vogel meer kenmerken pro Taiga dan pro Toendra. Maar met dit soort ongefundeerde stelligheid gaan we het rietganzenprobleem denk ik niet oplossen.
 
@ Lützen: Je laat prachtige foto's zien uit Finland en Duitsland. Maar zolang we verder niets over deze vogels weten, kunnen zulke plaatjes volgens mij noch voor het ene, noch voor het andere standpunt als munitie dienen. Ik deel overigens je mening dat die foto van Fred Hustings beter als rietgans spec de boeken in had kunnen gaan. Wellicht is men ook aan de andere kant van het spectrum soms te stellig...
Wat betreft de vogels uit Oudenhoorn: op het door jou gelinkte plaatje lijken het bijna johanseni's, maar op de andere foto's bij deze waarneming (b)lijken het toch klassieke Toendra's. Plakkende modder en/of grote opwinding kunnen ganzen een schijnbaar opvallend vlak voorhoofd bezorgen, niks nieuws toch?
Titel: Re: rietgans, again...
Bericht door: Fred Visscher op januari 12, 2011, 08:51:03 am
Pieter Geert,
Ik doelde uiteraard niet op foto's van vogels in broedgebieden en van de link van thomas en sovon,nee wat ik bedoelde is dat er vrijwel geen foto's zijn op deze en de db site waarbij de taiga's er echt goed genoeg op staan(ik zie namelijk geregeld foto's van vogels die ik hier ook genoeg in de polder tref waar ik dan weer geen taiga van maak).
En dan met name die snavels wat beter in beeld en of wat toendra's er omheen voor vergelijking,bij die van mij is dat iig allemaal een stuk beter te vergelijken,maar goed nogmaals we wachten het oordeel van Thomas af en mocht het anders zijn dan was dit iig een leerzame vogel.
En taiga vrouw had ik dan ook tussen aanhalingstekens gezet omdat die wat meer voor de hand ligt.
Vrgr Fred
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 12, 2011, 12:24:05 pm
@ Lützen: Je laat prachtige foto's zien uit Finland en Duitsland. Maar zolang we verder niets over deze vogels weten, kunnen zulke plaatjes volgens mij noch voor het ene, noch voor het andere standpunt als munitie dienen. Ik deel overigens je mening dat die foto van Fred Hustings beter als rietgans spec de boeken in had kunnen gaan. Wellicht is men ook aan de andere kant van het spectrum soms te stellig...
Wat betreft de vogels uit Oudenhoorn: op het door jou gelinkte plaatje lijken het bijna johanseni's, maar op de andere foto's bij deze waarneming (b)lijken het toch klassieke Toendra's. Plakkende modder en/of grote opwinding kunnen ganzen een schijnbaar opvallend vlak voorhoofd bezorgen, niks nieuws toch?

Mijn standpunt is dat het allemaal niet zo simpel is en dat zelfs de recente serie hele mooie klassieke Taiga's niet betekent dat de herkenning (en daaraan gerelateerd de taxonomie) van Taiga en Toendra nu appeltje eitje is. Heb daar eventueel nog wel meer munitie voor als daar interesse voor is.

Overigens is deze misschien nog wel interessant voor een UK perspectief. En wat een nuttige tabel!
http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/

Ben het helemaal met je eens dat de meeste vogels in Oudenhoorn Toendra's zijn. Vond deze 2 vogels er toch wel uitspringen (niet alleen de kopvorm, maar ook wat ik denk te zien aan snavelkleur, snavelvorm en neklengte) en ook omdat de vogel erachter volgens mij een Grauwe Gans is. Maar ik geef toe dat het geen knalharde vogels zijn en het is erg uitkijken met dit soort momentopname's vanuit tele-perspectief vandaar dat ik het had over een fishing-expedition. Ben trouwens blij dat je het wel met me eens bent wat betreft de Belgische vogel, die scoort inderdaad op veel meer punten.

Overigens denk ik dat de vogel van Fred een Taiga is, ongeacht of Thomas dan nu wel of niet met me eens is. Was er niet iets met de neklengte?
http://waarneming.nl/fotonew/6/1782986.jpg
en de snavelvorm?
  http://waarneming.nl/fotonew/6/1782956.jpg
en de nagel?
http://waarneming.nl/fotonew/9/1782959.jpg
en de vorm van het lichaam?
http://waarneming.nl/fotonew/9/1782949.jpg

Als deze vogel niet met zekerheid te determineren is komt dat m.i. eerder omdat we dat met individuele vogels schijnbaar niet aandurven dan dat deze vogel zelf nu zo afwijkend zou zijn.

Verder snap ik de reactie van Fred ook niet helemaal, maar ik ben nu wel heel nieuwsgierig geworden naar het soort vogels dat hij in de polder ziet. :)

Vanochtend overigens 35 vogels in het Vlijmens Ven, maar helaas nog verder weg dan op Maandag. Sneeuwvlokje er nog niet tussen kunnen vinden, dus of het dezelfde groep is nog onzeker (al ligt het wel voor de hand).

Lutzen
Titel: Re: rietgans, again...
Bericht door: f_a_roos op januari 12, 2011, 17:33:32 pm
Ik heb deze discussie enigszins gevolgd, in ieder geval de draad gelezen en de voorbeeldfoto's bekeken. Hoongelach zal mij waarschijnlijk ten deel vallen, bovendien ben ik geen kenner, maar wat is de issue?

Ik heb zelf het gevoel, heb het spelletje gedaan, dat ik de Taiga's er zo uitpik op basis van de snavelvorm evt. in combinatie met de halslengte. Komt aardig overeen met wat Lützen aangeeft.
Titel: Re: rietgans, again...
Bericht door: Klaas van Dijk op januari 12, 2011, 17:35:08 pm
Nu nog eens foto's van vlijmen of andere bekende plekken waar je wat aan hebt want ik kan er weinig mee. (....). Daarom denk ik dat je echt alleen maar wat kan zeggen en ook over groepjes in goede gebieden,als er dus duidelijke foto's zijn. Fred

Beste Fred, ik zit ook al tijden te wachten op echt goede & duidelijke foto's. Eerlijk gezegd kan ik ook weinig met matige / vage foto's. De liefhebbers van grote meeuwen plaatsen voortdurend duidelijke foto's op hun forum ( http://www.talk.gull-research.org/index.php (http://www.talk.gull-research.org/index.php) ). En dan weet je als leek in ieder geval waar het over gaat & kun je zelf oordelen of het klopt of niet. Tuurlijk, een grote meeuw fotograferen op een vuilnisbelt, in een stadspark of in een vissershaven is gemakkelijker dan een Taigarietgans in een open weiland / akker. Maar jouw foto's laten zien dat het dus wel kan.
 
Groetjes, Klaas
Titel: Re: rietgans, again...
Bericht door: Guus Peterse op januari 12, 2011, 17:36:08 pm
Ik heb deze discussie enigszins gevolgd, in ieder geval de draad gelezen en de voorbeeldfoto's bekeken. Hoongelach zal mij waarschijnlijk ten deel vallen, bovendien ben ik geen kenner, maar wat is de issue?

Ik heb zelf het gevoel, heb het spelletje gedaan, dat ik de Taiga's er zo uitpik op basis van de snavelvorm evt. in combinatie met de halslengte. Komt aardig overeen met wat Lützen aangeeft.

 Nou ja, het gaat natuurlijk om de eventuele taiga's die je er niet zo uitpikt.
Titel: Re: rietgans, again...
Bericht door: f_a_roos op januari 12, 2011, 17:57:16 pm
Zover was ik natuurlijk ook wel, maar is het vnl. de snavelvorm, of de lengte van de hals, of de bult op de borst, de nagel. Ik heb het idee snavelvorm (dikte ondersnavel en holle welving)?

Ik heb deze discussie enigszins gevolgd, in ieder geval de draad gelezen en de voorbeeldfoto's bekeken. Hoongelach zal mij waarschijnlijk ten deel vallen, bovendien ben ik geen kenner, maar wat is de issue?

Ik heb zelf het gevoel, heb het spelletje gedaan, dat ik de Taiga's er zo uitpik op basis van de snavelvorm evt. in combinatie met de halslengte. Komt aardig overeen met wat Lützen aangeeft.

 Nou ja, het gaat natuurlijk om de eventuele taiga's die je er niet zo uitpikt.
Titel: Re: rietgans, again...
Bericht door: JohanvantBosch op januari 12, 2011, 18:18:54 pm
als je het topic leest, frank, zul je zien dat er eigenlijk geen vooral is... je wilt juist dat ze aan alle kenmerken voldoen. en... - ik weet niet waar jij ze tussenuit pikt - het idee is de laatste tijd dat ze juist niet tussen de toendra's zitten.
Titel: Re: rietgans, again...
Bericht door: f_a_roos op januari 12, 2011, 18:32:27 pm
Johan, dank voor je geduld.

Ik heb dit natuurlijk ook gelezen http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/ daaruit volgt  "flock structure: loose"; "tussenuit pikken" bedoelde ik de foto's van twijfelgevallen.

Wat vind je van deze: http://www.club300.de/gallery/photo.php?id=16924

Wat is de linker wat is de rechter?

als je het topic leest, frank, zul je zien dat er eigenlijk geen vooral is... je wilt juist dat ze aan alle kenmerken voldoen. en... - ik weet niet waar jij ze tussenuit pikt - het idee is de laatste tijd dat ze juist niet tussen de toendra's zitten.
Titel: Re: rietgans, again...
Bericht door: theomuusse op januari 12, 2011, 21:53:36 pm
Johan, dank voor je geduld.

Ik heb dit natuurlijk ook gelezen http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/ (http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/) daaruit volgt  "flock structure: loose"; "tussenuit pikken" bedoelde ik de foto's van twijfelgevallen.

Wat vind je van deze: http://www.club300.de/gallery/photo.php?id=16924 (http://www.club300.de/gallery/photo.php?id=16924)

Wat is de linker wat is de rechter?

als je het topic leest, frank, zul je zien dat er eigenlijk geen vooral is... je wilt juist dat ze aan alle kenmerken voldoen. en... - ik weet niet waar jij ze tussenuit pikt - het idee is de laatste tijd dat ze juist niet tussen de toendra's zitten.

Toendra's.
Kijk maar naar de middelste 2. De linker onder voorbehoud, die vind ik echt lastig.

Theo
Titel: Re: rietgans, again...
Bericht door: f_a_roos op januari 13, 2011, 10:19:22 am
Bedankt, ik zie nu waarom het zo lastig is. Vond zelf de dunne nekken van 2 ex. minder Toendra, vooral de meest rechtse, maar de snavels van deze exemplaren ... Mijn redenering is dat Toendra's dikke nekken en korte stevige snavels moeten hebben om gras te scheuren met veel kracht. De Taiga's zullen denk ik meer knoppen plukken van boompjes of struiken, dus langere dunnere nekken en een "pincet"-snavel. De redenering gaat dus niet op.

Johan, dank voor je geduld.

Ik heb dit natuurlijk ook gelezen http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/ (http://www.binocularface.co.uk/2010/12/15/bean-geese-witchcraft/) daaruit volgt  "flock structure: loose"; "tussenuit pikken" bedoelde ik de foto's van twijfelgevallen.

Wat vind je van deze: http://www.club300.de/gallery/photo.php?id=16924 (http://www.club300.de/gallery/photo.php?id=16924)

Wat is de linker wat is de rechter?

als je het topic leest, frank, zul je zien dat er eigenlijk geen vooral is... je wilt juist dat ze aan alle kenmerken voldoen. en... - ik weet niet waar jij ze tussenuit pikt - het idee is de laatste tijd dat ze juist niet tussen de toendra's zitten.

Toendra's.
Kijk maar naar de middelste 2. De linker onder voorbehoud, die vind ik echt lastig.

Theo
Titel: Re: rietgans, again...
Bericht door: Fred Visscher op januari 13, 2011, 17:36:12 pm
@Pieter Geert: Wat betreft de grootte van de vogel voeg ik even twee foto's toe om een beeld te krijgen van de grootte en de bouw die tijdens de waarneming erg opviel.
Wellicht is het gedrag van een solitaire "taiga vrouw"in zo'n grote groep toendra's anders,normaal draagt het mannetje daar immers zorg voor(Joost mag het weten).
De foto's tonen dus een paartje toendra's en de combinatie van zeer waarschijnlijk een vrouw toendra met daar achter en lager in een natte greppel staande "taiga".
Duidelijk is natuurlijk dat die vrouw ook al staat ze vooraan en hoger,niet in de buurt komt van de grootte van de vogel waar het om gaat.
Wat mij zelf opvalt is b.v het borstgebeuren en dus die nek maar ook de onderkant die veel meer horizontale lengte lijkt te hebben etc.
En als ik deze combinatie weer vergelijk met de foto van het paartje toendra's,en met name naar het mannetje kijk dan word mijn geloof in taiga als maar groter en dat allemaal vanwege het gehele overkomen.
Verder kan ik er ook niks meer aan toevoegen...
Vrgr Fred
 
 
Titel: Re: rietgans, again...
Bericht door: lupokatja op januari 13, 2011, 23:37:17 pm
En als ik deze combinatie weer vergelijk met de foto van het paartje toendra's,en met name naar het mannetje kijk dan word mijn geloof in taiga als maar groter en dat allemaal vanwege het gehele overkomen.
Verder kan ik er ook niks meer aan toevoegen...
Vrgr Fred

Je hoeft je m.i. echt geen zorgen te maken over die Taiga van je. Kijk bijv. eens in detail naar de vorm van de snavel van deze Finse vogels:

http://jtenovuo.1g.fi/kuvat/02%20joutsenet%2C%20hanhet%2C%20merimetsot%2C%20pelikaanit%20-%20swans%2C%20geese%2C%20cormorants%2C%20pelicans/mets%E4hanhi%20-%20bean%20goose/mets%E4hanhi%2012%20Siikajoki%2005-05.jpg/full (http://jtenovuo.1g.fi/kuvat/02%20joutsenet%2C%20hanhet%2C%20merimetsot%2C%20pelikaanit%20-%20swans%2C%20geese%2C%20cormorants%2C%20pelicans/mets%E4hanhi%20-%20bean%20goose/mets%E4hanhi%2012%20Siikajoki%2005-05.jpg/full)

http://jtenovuo.1g.fi/kuvat/02%20joutsenet%2C%20hanhet%2C%20merimetsot%2C%20pelikaanit%20-%20swans%2C%20geese%2C%20cormorants%2C%20pelicans/mets%E4hanhi%20-%20bean%20goose/mets%E4hanhi%2013%20Siikajoki%2005-05.jpg/full (http://jtenovuo.1g.fi/kuvat/02%20joutsenet%2C%20hanhet%2C%20merimetsot%2C%20pelikaanit%20-%20swans%2C%20geese%2C%20cormorants%2C%20pelicans/mets%E4hanhi%20-%20bean%20goose/mets%E4hanhi%2013%20Siikajoki%2005-05.jpg/full)

Probleem met de vergelijking met die Toendra’s is dat je er vanuit gaat dat er zoiets bestaat als DE Toendrarietgans. Als je veel rietganzen hebt gezien kun je volgens mij niet anders dan concluderen dat er meerdere typen Toendrarietgans bestaan. Dat geldt waarschijnlijk ook voor DE Taigarietgans of misschien wel voor DE rietgans. Kijk bijv. eens naar deze Taiga’s uit Norfolk:

http://www.binocularface.co.uk/wp-content/up