Geavanceerd zoeken  

Nieuws:

Pagina's: [1]   Omlaag

Auteur Topic: Oostelijk Resedawitje Pontia edusa nieuw voor Nederland  (gelezen 1040 keer)

0 leden en 1 gast bekijken dit topic.

pdeknijff

  • Member
  • Offline Offline
  • Berichten: 701
Oostelijk Resedawitje Pontia edusa nieuw voor Nederland
« Gepost op: januari 21, 2019, 10:26:35 am »

Men heeft al lang het vermoeden dat alle Resedawitjes Pontia daplidice / edusa welke toch min-of-meer regelmatig in Nederland als zwervers worden waargenomen, Oostelijk Resedawitjes Pontia edusa betreffen en niet Resedawitje Pontia daplidice. Omdat de herkenning van deze twee taxa in het veld onmogelijk wordt geacht (https://forum.waarneming.nl/smf/index.php?topic=365251.0), maar wel relatief eenvoudig door middel van mtDNA onderzoek mogelijk is, werd besloten om één van de exemplaren welke het afgelopen jaar in Nederland werden waargenomen te verzamelen t.b.v van DNA-onderzoek.

Op 4 september 2018 (https://waarneming.nl/observation/162138108/) werd 1 exemplaar gevangen en ter beschikking gesteld aan het lab van één van ondergetekenden (PdK) voor nader onderzoek. Van deze vlinder (lab-code RWPS02, zie bijgevoegde foto) werd uit een pootje DNA geïsoleerd, en m.b.v. de PCR-primers LepF en LepR (uit Dincă et al. 2015) werd een fragment van 658 bp. van het mitochondriale COI-gen gesequenced. De verkregen sequentie werd via het publiekelijk toegankelijke onlineprogramma Blastn vergeleken met eerder verkregen sequenties van diverse Pontia taxa. Het resultaat was overduidelijk, de sequentie van RWPS02 kwam volledig overeen met een hele reeks van betrouwbare sequenties van exemplaren welke als Pontia edusa, dus Oostelijk Resedawitje waren opgenomen in GenBank en verschilde duidelijk van betrouwbare Resedawitje Pontia daplidice sequencties.

Hiermee is deze waarneming dus het eerste formele bewijs dat Oostelijk Resedawitje Pontia edusa in Nederland voorkomt. Nadere details en gegevens betreffende andere exemplaren en analyses zullen later worden gepubliceerd en na publicatie via dit forum worden gedeeld. Onderstaande sequentie (en anderen) zullen na publicatie in GenBank worden gedeponeerd.

Referentie
Vlad Dincă et al. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity. Scientific Reports 2015: 5: 12395 (https://www.nature.com/articles/srep12395).

COI-sequentie van RWPS02:
AACTCTATATTTTATTTTCGGAATTTGATCCGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAACCCTGGTGCTTTAATTGGAGATGACCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT
ATAATTGGAGGATTCGGAAATTGACTTGTCCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTGTACCCCC
CACTTTCATCTAATATTGCCCATAGTGGATCATCAGTAGATTTAGCTATCTTTTCATTACACTTAGCGGGTATTTCTTCAATCCTTGGAGCAATTAACTTTATTACAACTATTATTAATATACGAATTAGAAATATGTCATTTGACCAAATACCTTTATTTGTGTGAGCAGT
AGGAATTACCGCCTTACTTTTACTTTTATCCTTACCAGTTCTTGCTGGGGCAATTACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGACCCAATTCTTTATCAACACTTATTC

21 januari 2019,

Paul Vossen
Peter de Knijff
« Laatst bewerkt op: januari 21, 2019, 10:29:28 am door pdeknijff »
Gelogd
Met vriendelijke groet,

Peter de Knijff
Pagina's: [1]   Omhoog
 

Pagina opgebouwd in 0.042 seconden met 19 queries.